ID: 1084537352 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:69764847-69764869 |
Sequence | CTACATGGGGTCCTGGGGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1084537337_1084537352 | 8 | Left | 1084537337 | 11:69764816-69764838 | CCAGTTCTTCTAGCTCGATCCAG | No data | ||
Right | 1084537352 | 11:69764847-69764869 | CTACATGGGGTCCTGGGGGAGGG | No data | ||||
1084537336_1084537352 | 9 | Left | 1084537336 | 11:69764815-69764837 | CCCAGTTCTTCTAGCTCGATCCA | No data | ||
Right | 1084537352 | 11:69764847-69764869 | CTACATGGGGTCCTGGGGGAGGG | No data | ||||
1084537335_1084537352 | 10 | Left | 1084537335 | 11:69764814-69764836 | CCCCAGTTCTTCTAGCTCGATCC | No data | ||
Right | 1084537352 | 11:69764847-69764869 | CTACATGGGGTCCTGGGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1084537352 | Original CRISPR | CTACATGGGGTCCTGGGGGA GGG | Intergenic | ||