ID: 1084537355

View in Genome Browser
Species Human (GRCh38)
Location 11:69764858-69764880
Sequence GCACAGACCCACCCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537355_1084537358 7 Left 1084537355 11:69764858-69764880 CCTGGGGGAGGGTGGGTCTGTGC No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537355_1084537368 23 Left 1084537355 11:69764858-69764880 CCTGGGGGAGGGTGGGTCTGTGC No data
Right 1084537368 11:69764904-69764926 CCACAGGACATGGACCAGCACGG No data
1084537355_1084537362 13 Left 1084537355 11:69764858-69764880 CCTGGGGGAGGGTGGGTCTGTGC No data
Right 1084537362 11:69764894-69764916 CCCTTCCCCACCACAGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537355 Original CRISPR GCACAGACCCACCCTCCCCC AGG (reversed) Intergenic