ID: 1084537357

View in Genome Browser
Species Human (GRCh38)
Location 11:69764862-69764884
Sequence GGGGAGGGTGGGTCTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537348_1084537357 -4 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537335_1084537357 25 Left 1084537335 11:69764814-69764836 CCCCAGTTCTTCTAGCTCGATCC No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537350_1084537357 -7 Left 1084537350 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537336_1084537357 24 Left 1084537336 11:69764815-69764837 CCCAGTTCTTCTAGCTCGATCCA No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537337_1084537357 23 Left 1084537337 11:69764816-69764838 CCAGTTCTTCTAGCTCGATCCAG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537342_1084537357 4 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537344_1084537357 -2 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data
1084537346_1084537357 -3 Left 1084537346 11:69764842-69764864 CCCTCCTACATGGGGTCCTGGGG No data
Right 1084537357 11:69764862-69764884 GGGGAGGGTGGGTCTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537357 Original CRISPR GGGGAGGGTGGGTCTGTGCT GGG Intergenic