ID: 1084537358

View in Genome Browser
Species Human (GRCh38)
Location 11:69764888-69764910
Sequence CTGTCCCCCTTCCCCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084537342_1084537358 30 Left 1084537342 11:69764835-69764857 CCAGGACCCCTCCTACATGGGGT No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537344_1084537358 24 Left 1084537344 11:69764841-69764863 CCCCTCCTACATGGGGTCCTGGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537346_1084537358 23 Left 1084537346 11:69764842-69764864 CCCTCCTACATGGGGTCCTGGGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537348_1084537358 22 Left 1084537348 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537355_1084537358 7 Left 1084537355 11:69764858-69764880 CCTGGGGGAGGGTGGGTCTGTGC No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data
1084537350_1084537358 19 Left 1084537350 11:69764846-69764868 CCTACATGGGGTCCTGGGGGAGG No data
Right 1084537358 11:69764888-69764910 CTGTCCCCCTTCCCCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084537358 Original CRISPR CTGTCCCCCTTCCCCACCAC AGG Intergenic