ID: 1084539096

View in Genome Browser
Species Human (GRCh38)
Location 11:69775425-69775447
Sequence CCACAGCGCCCCGGGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 272}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084539096_1084539109 21 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539109 11:69775469-69775491 CGCCTGCCAATCAGGGCCGGGGG 0: 1
1: 0
2: 1
3: 6
4: 90
1084539096_1084539114 29 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539114 11:69775477-69775499 AATCAGGGCCGGGGGAAGGGAGG 0: 1
1: 0
2: 0
3: 47
4: 411
1084539096_1084539103 13 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539103 11:69775461-69775483 TCGCAGGCCGCCTGCCAATCAGG 0: 1
1: 0
2: 0
3: 7
4: 41
1084539096_1084539108 20 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539108 11:69775468-69775490 CCGCCTGCCAATCAGGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1084539096_1084539105 18 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539105 11:69775466-69775488 GGCCGCCTGCCAATCAGGGCCGG 0: 1
1: 0
2: 1
3: 10
4: 106
1084539096_1084539112 26 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539112 11:69775474-69775496 GCCAATCAGGGCCGGGGGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 171
1084539096_1084539102 -3 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539102 11:69775445-69775467 TGGCGTTCGCGGCTGGTCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 15
1084539096_1084539111 25 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539111 11:69775473-69775495 TGCCAATCAGGGCCGGGGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 181
1084539096_1084539106 19 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539106 11:69775467-69775489 GCCGCCTGCCAATCAGGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 148
1084539096_1084539104 14 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539104 11:69775462-69775484 CGCAGGCCGCCTGCCAATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1084539096_1084539101 -10 Left 1084539096 11:69775425-69775447 CCTGGGCGCCCGGGGCGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 272
Right 1084539101 11:69775438-69775460 GGCGCTGTGGCGTTCGCGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084539096 Original CRISPR CCACAGCGCCCCGGGCGCCC AGG (reversed) Intergenic
900100725 1:960955-960977 CACCCGCGCCCCGCGCGCCCAGG + Intronic
901208152 1:7509037-7509059 CCACAGCAGCCAGGGAGCCCAGG - Intronic
904252998 1:29237858-29237880 CGGCTGCGCCCCGGGCGGCCGGG + Intronic
904772211 1:32886634-32886656 CCCCAGCGCCCCCGCCACCCGGG - Intronic
906241173 1:44243114-44243136 CCACTGCCCCCCTGGGGCCCAGG + Intronic
906627013 1:47333796-47333818 CGACAGGGCCGCGGACGCCCGGG + Exonic
906719770 1:47996794-47996816 CCCCCGCGCCCCGCGGGCCCTGG - Exonic
906960885 1:50419004-50419026 GCCCAGCGCCCCAGGCGCCATGG + Exonic
911144760 1:94541669-94541691 CCCCAGCCCCACGGGCGCCACGG - Exonic
911647605 1:100352773-100352795 GGTCAGCGCGCCGGGCGCCCCGG - Exonic
915345518 1:155195120-155195142 CCAGCGCGCCCCGGGTTCCCGGG + Intergenic
915458146 1:156053892-156053914 CCACAGCGCCCCGGGCGGACCGG + Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
917973711 1:180225237-180225259 CCACAGAGCCCCGGGAGAGCAGG + Intergenic
917974803 1:180231621-180231643 GCAGGGCGCCCCGGGCACCCTGG + Intronic
923171643 1:231422218-231422240 CCTCAGCGTCCCGGGCGGCCCGG + Exonic
923665178 1:235993017-235993039 ACACAGGGCCCCTGGCCCCCAGG + Intronic
924172600 1:241357312-241357334 CCACACCGCCCGGGCCTCCCGGG + Intergenic
1063114933 10:3066922-3066944 CCACAACGGCCCGAGCGGCCGGG + Intronic
1063393575 10:5666210-5666232 CCACCGAGCGCCGCGCGCCCTGG - Intronic
1067477973 10:46578851-46578873 CCCTGGCGCCCCTGGCGCCCGGG + Intronic
1067556993 10:47279456-47279478 CCACAGCACCCCGTGGGACCTGG - Intergenic
1067616766 10:47762936-47762958 CCCTGGCGCCCCTGGCGCCCGGG - Intergenic
1069878207 10:71576055-71576077 CCACAGAGCCCTGCCCGCCCAGG + Intronic
1069992559 10:72324202-72324224 CCCCAGAGCCCTGGGCCCCCAGG - Intergenic
1072915974 10:99537465-99537487 TCTCAGCGCCCCGGCCGGCCCGG - Intergenic
1074377675 10:112952356-112952378 CCGCAGGGCCGCGAGCGCCCTGG + Intronic
1075480538 10:122777802-122777824 ACACGGTGCCCCAGGCGCCCTGG - Intergenic
1075801741 10:125159076-125159098 CCCCAGCGCCCCGGGCGAGTTGG - Intronic
1076096435 10:127737495-127737517 CCTCGGCGCCCCGGGCGGCCTGG + Exonic
1076917818 10:133433207-133433229 CCACAGCACCCCGGGCGACGTGG + Intergenic
1076937816 10:133577284-133577306 CCACAGCACCCCGGGCGACGTGG + Intergenic
1076945017 10:133640697-133640719 CCACAGCCCCGGGGGCGCGCGGG - Intergenic
1077010364 11:376742-376764 CCCCAGCGCCGCGTGCGCCCTGG + Exonic
1077323834 11:1954810-1954832 CGGCAGCCCCCAGGGCGCCCTGG + Intronic
1077491511 11:2862940-2862962 CCCCACCGCCCGGGCCGCCCCGG - Intergenic
1078987128 11:16607277-16607299 TCACAGCGGGCCGCGCGCCCTGG + Intronic
1080034850 11:27700356-27700378 CCGTAGCGCCTCGGGCTCCCGGG - Intronic
1083457138 11:62786815-62786837 CCACGGCTCCGCGGCCGCCCGGG + Exonic
1083678263 11:64340016-64340038 CCACAGCTCCCCTGGCTCCATGG - Intergenic
1083812455 11:65113192-65113214 CCACAGCGCACAGTGAGCCCTGG - Intronic
1084539096 11:69775425-69775447 CCACAGCGCCCCGGGCGCCCAGG - Intergenic
1089624266 11:119741408-119741430 CCGCAGGGTCCCAGGCGCCCAGG - Intergenic
1089864045 11:121616452-121616474 CCACAGAGCCACGGGAGCCAAGG - Intronic
1202806820 11_KI270721v1_random:10005-10027 CGGCAGCCCCCAGGGCGCCCTGG + Intergenic
1092108942 12:5945399-5945421 CCGCTGCGCCCTGGGCGCCCGGG + Intronic
1095989910 12:48027472-48027494 CCACAGAGCCCGGGTCCCCCAGG + Intergenic
1096191635 12:49623634-49623656 CCACAGCGCCCCCTGCGGCCCGG + Intronic
1101892845 12:108731606-108731628 GCACAGCGGCCCGGCAGCCCTGG - Intergenic
1103188630 12:118981844-118981866 GGACAGCGCCCCGGACGCCCCGG + Exonic
1103562520 12:121800074-121800096 CCCCAGCGGCCCGGGCGGCCGGG + Intronic
1104686334 12:130787453-130787475 CCACACCACCCCGGGCTCCACGG + Intergenic
1104730395 12:131102530-131102552 CCACAGCGTCCCAGGTGCCCTGG + Intronic
1104866896 12:131961216-131961238 CCAGATCGCCCAGGGAGCCCAGG + Exonic
1104885445 12:132104584-132104606 CCAGATCGCCCAGGGAGCCCAGG + Exonic
1105202760 13:18194234-18194256 CCCCAGCGGCCCGTGCGCCCCGG + Intergenic
1105964549 13:25372394-25372416 CCAGAGAGCCCAGGGAGCCCAGG - Intronic
1106242011 13:27920288-27920310 CCAGCGCGCCCAGGGCGCCAGGG - Exonic
1107467805 13:40665817-40665839 CGACAGCGGCCCGGGCGGCGGGG + Exonic
1108542460 13:51456599-51456621 CCACAGTGCCCATGGCGCCCAGG + Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1112771452 13:102799089-102799111 TCCCGGCGCCCCGGGCTCCCTGG + Exonic
1112771733 13:102800262-102800284 CAACAGCGTCCCCGGGGCCCGGG + Intronic
1113656126 13:112068588-112068610 CCAGAGAGCCCAGCGCGCCCAGG - Exonic
1113759127 13:112835464-112835486 CCACAGCACCCTGGGCTTCCCGG + Intronic
1113833140 13:113312643-113312665 ACACAGGGCCCCGGGGGCCGTGG + Intronic
1114458466 14:22872219-22872241 CGGCGGAGCCCCGGGCGCCCAGG - Exonic
1115849995 14:37583757-37583779 CCAGCGCGCCCCGGGCACCAGGG + Intergenic
1117563252 14:56967392-56967414 CCACAGCCCCCTGAGCTCCCTGG - Intergenic
1117803135 14:59465068-59465090 CCCCAGCGCCGCGGTCGCCACGG + Exonic
1118680755 14:68239192-68239214 CCACATCCCCCCAGGTGCCCAGG - Intronic
1119559391 14:75578412-75578434 CCCCCACGCCCCGGGCGCCATGG - Intergenic
1122315531 14:100824208-100824230 CGACAGCCTCCCGGGCCCCCGGG + Intergenic
1122625730 14:103084506-103084528 CCCCAGCGCCGCGGGATCCCAGG - Intergenic
1122779111 14:104136235-104136257 CGACAGCGCCCCTTCCGCCCCGG - Intergenic
1122883296 14:104699656-104699678 CCACAGTGCACCGGGGGCTCCGG + Intronic
1122975455 14:105168935-105168957 CCCCCGCCGCCCGGGCGCCCTGG - Intergenic
1123032617 14:105458980-105459002 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032702 14:105459216-105459238 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032766 14:105459393-105459415 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032809 14:105459511-105459533 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032872 14:105459688-105459710 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032936 14:105459865-105459887 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123032957 14:105459924-105459946 ACACAGCTCCCCAGGCGCCAGGG - Intronic
1123042114 14:105494536-105494558 CCACAGAGCCCCGGTCGCCGGGG - Intronic
1124017166 15:25887055-25887077 CCACAGAGCCTCTGGAGCCCAGG + Intergenic
1125640993 15:41230800-41230822 CCCCAGCGCCCCCTGCGGCCGGG + Intergenic
1125721008 15:41845153-41845175 CCACAGCGGCCTGGGTGCCCAGG - Intronic
1125932179 15:43608187-43608209 CCACAGGGCTCTGGGCACCCTGG - Exonic
1125945277 15:43707661-43707683 CCACAGGGCTCTGGGCACCCTGG - Intergenic
1126746424 15:51830091-51830113 CACCCGCGGCCCGGGCGCCCGGG + Intronic
1129051255 15:72783680-72783702 CCACAGCGCCATGGGGACCCAGG + Exonic
1129387183 15:75202459-75202481 CCTCAGCGCCCGGCGCCCCCAGG - Intronic
1129450291 15:75647731-75647753 CTGCAGCGCCCCGGGCCCGCGGG + Intronic
1130517023 15:84633547-84633569 CCTCAGCGTCCCGGGCGGCCCGG - Intergenic
1130662360 15:85840689-85840711 CCACCCAGCCCCTGGCGCCCTGG + Intergenic
1132544654 16:527730-527752 TCACAGCGCCGCGTGCGCCCCGG + Intronic
1132987707 16:2776758-2776780 CCACGGTGCCCTCGGCGCCCGGG + Intronic
1133272026 16:4614968-4614990 CCACGGTGCGCCGGGCGCCCCGG + Intronic
1134018790 16:10907442-10907464 CGACAGCCCCCCCGGGGCCCTGG + Exonic
1135400343 16:22162538-22162560 ACGCAGCGCCGCGGGAGCCCGGG + Intergenic
1136573181 16:31108770-31108792 CCCCAGCGCCCCGGGGTCCCGGG - Intronic
1137555931 16:49470358-49470380 CCACACAACCCCGGGCCCCCAGG - Intergenic
1137729209 16:50677495-50677517 CCAGAGCACCCTGGGAGCCCTGG - Exonic
1137787668 16:51151671-51151693 CCACTGCGGGCCCGGCGCCCCGG + Intergenic
1139529892 16:67537847-67537869 CCCCACCGGCCCGGGCGTCCCGG - Intronic
1139591317 16:67934870-67934892 CCACATTGCCCCCGGAGCCCAGG + Exonic
1139871877 16:70114488-70114510 CCTAAGCGCCCCGGGACCCCTGG + Intronic
1139890768 16:70252016-70252038 CTACAGCGCCCCTGGAGGCCCGG + Intergenic
1140364050 16:74367995-74368017 CCTAAGCGCCCCGGGACCCCTGG - Intergenic
1142143678 16:88483656-88483678 CCACAGTGGCCCGGACACCCAGG + Intronic
1142764669 17:2058489-2058511 CGCCAGCGCCCCGGCCGCGCCGG - Exonic
1143134452 17:4703828-4703850 CCACAGGGCCGCGGGCACGCGGG + Intronic
1143172354 17:4937680-4937702 CCACTGCGCCCTGGGGGCCTGGG - Exonic
1144756173 17:17681808-17681830 ACACTGCGCCCCCCGCGCCCCGG - Intronic
1145200318 17:20938775-20938797 CCACAGCTCCCCGGTGGCCATGG - Intergenic
1148558834 17:48594466-48594488 CCACAGCGCCCAGGCCGAGCCGG + Intronic
1148652606 17:49260531-49260553 GCACAGTGCTCCGGGCGCCCGGG - Intergenic
1148698643 17:49575700-49575722 CTAGAGCGCTCCTGGCGCCCAGG - Intergenic
1151304427 17:73253893-73253915 CCACAGCCCCTAGGGCTCCCTGG + Intronic
1151414570 17:73952888-73952910 CCAAAGCTCCCCGGACGCCGCGG + Intergenic
1151627637 17:75287390-75287412 CCACAGCGCCCGGCACGCCATGG + Exonic
1151802344 17:76385598-76385620 CCACAGCGCCAGGGACCCCCTGG + Exonic
1152031605 17:77846563-77846585 CCACAGAGCCCCTGGCACCCAGG + Intergenic
1152093325 17:78258635-78258657 TCACGGCGCCCCCGGCTCCCTGG + Intergenic
1152468247 17:80477295-80477317 CCCCAGCGCCCCGCCCGCACGGG - Intronic
1152568173 17:81109539-81109561 CCACAGGGGCCGGGGCGGCCAGG - Intronic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1153997651 18:10455245-10455267 GCAAAGAGCTCCGGGCGCCCTGG - Intronic
1154485323 18:14867714-14867736 CCACAGTGCCCGGGGCTCCCTGG - Intergenic
1158964591 18:62611671-62611693 CCACAGAGACCCGGGCTTCCTGG + Intergenic
1159040704 18:63320458-63320480 CCACCGCGCCGCGGCCGCGCGGG - Intergenic
1159045582 18:63366726-63366748 CCACAGAACCCCTGGGGCCCCGG + Intronic
1160366176 18:78327802-78327824 CCCAAGCTCCCCGGGCTCCCCGG + Intergenic
1160738739 19:676431-676453 CCAGAGTGGCCCTGGCGCCCCGG - Exonic
1160763751 19:798097-798119 CCCCTGCCCCCCGTGCGCCCCGG + Intronic
1160765657 19:806427-806449 CCACGGCGCCCTGGCCCCCCTGG + Exonic
1161074036 19:2276361-2276383 GCACACTGCCCGGGGCGCCCTGG - Exonic
1161316214 19:3618835-3618857 CCGCAGCTCCCCTGGAGCCCAGG + Intronic
1162524137 19:11197633-11197655 CTCCAGCCGCCCGGGCGCCCCGG + Intronic
1162524141 19:11197642-11197664 CCACCGCGGCCGGGGCGCCCGGG - Intronic
1163370420 19:16898030-16898052 GCTCAGCGCCCCGGGCCTCCTGG - Intronic
1163713107 19:18858651-18858673 CCACAGCGTCCCCAGAGCCCAGG + Intronic
1165236870 19:34428634-34428656 CCTCAGAGCCCCTGGAGCCCCGG - Intronic
1165859539 19:38900083-38900105 CGACAGCGGCCTGGGCTCCCTGG + Exonic
1166731859 19:45063895-45063917 CCACAGCGACCCGGGAAACCAGG - Intronic
1167040313 19:47019880-47019902 CCGCTGCGCCCCGCGCGCCCCGG + Exonic
1167071901 19:47226683-47226705 GCCCAGCGCCCCGGGGGCTCTGG - Exonic
1167407749 19:49324898-49324920 CCACAGAGCCCAGGGCAACCAGG + Intronic
1167491056 19:49792804-49792826 CCACGGGGCCTCGGGCGCCATGG - Intronic
1167772629 19:51530646-51530668 CCTCAGGGACCCGGGCGTCCTGG + Intronic
1168307192 19:55442210-55442232 CCCGTGCGCCCCGGGCGCACCGG - Exonic
925134459 2:1516517-1516539 CCACAGGACCCAGGGAGCCCTGG - Intronic
926148254 2:10410074-10410096 CCACGGCGCCCCGGCCAGCCTGG + Intronic
927716998 2:25359538-25359560 CAAGAGAGCCCCGGGCCCCCTGG - Intergenic
928195934 2:29216440-29216462 CCACAGCGCTCCAGGCTCCTGGG - Intronic
928301711 2:30131035-30131057 CCACACAGCCCCGCCCGCCCGGG - Intergenic
928998742 2:37324840-37324862 CCCCCGCCCCCCGCGCGCCCCGG - Intergenic
931516100 2:63051462-63051484 CGACAGCGCCCCGGGGTCCTCGG - Intronic
932122137 2:69111849-69111871 CCACAGCAGCCCTGGAGCCCAGG - Intronic
933688128 2:85159285-85159307 CCAGGGAGCCCCGGGCGCCTGGG - Intronic
936088741 2:109487712-109487734 CCACAGGGCCCAAGGTGCCCTGG + Intronic
937221915 2:120346721-120346743 CCACCGCAGCCCGCGCGCCCTGG + Intronic
937999149 2:127718945-127718967 CCACAGCTCTCCTGGAGCCCTGG + Intronic
938114490 2:128594090-128594112 CCACAGCTGCTCGGGTGCCCAGG - Intergenic
938227349 2:129627298-129627320 CCACAGCCACCCTGGCACCCAGG - Intergenic
938319920 2:130355912-130355934 CCACAGCGGCCCGAGCGCCCGGG + Intergenic
938766222 2:134462100-134462122 CCACAGAGCACAGGGCCCCCTGG + Intronic
942868091 2:180699787-180699809 CCACAGCACCCATGGCACCCAGG + Intergenic
946311221 2:218883576-218883598 AAACAGCGCCCGGGGCGCGCGGG - Intronic
946727051 2:222671508-222671530 CTACAGCGGCCCGGGCGCATTGG - Intergenic
946966423 2:225042202-225042224 CCCGCGCGCCCCAGGCGCCCGGG - Intronic
947736791 2:232459337-232459359 GCTCAGCTCCCAGGGCGCCCTGG - Exonic
948258254 2:236584097-236584119 CCACAGGGCCCAGGGCACCGTGG + Intergenic
948407965 2:237736985-237737007 CCAGAGCGGCCCCGGCGCCCAGG + Intronic
949004284 2:241636818-241636840 CCCCCGCGCCCCGGCCGCCGAGG + Intronic
1168951211 20:1803412-1803434 CCCCGAGGCCCCGGGCGCCCCGG + Intergenic
1168986773 20:2055931-2055953 CCACAGCTCCCTGGGCTCCCTGG + Intergenic
1169065636 20:2692986-2693008 CGCCAGCGCCCCGCGTGCCCCGG - Exonic
1170842449 20:19935023-19935045 CCACAGCGCCCGGGGAACTCAGG - Intronic
1174287415 20:49482936-49482958 GGACAGCGCCCCGGGCGGCTGGG - Intergenic
1175214633 20:57385392-57385414 CCACCGCGCACCGGGCTCCCAGG + Intergenic
1175215806 20:57391305-57391327 CCGCCCCGCCCCGGGCGCGCGGG - Intergenic
1175225777 20:57443048-57443070 CCACAGCGTCACAGGCGTCCTGG - Intergenic
1175428692 20:58888545-58888567 CCAGAGCCCCCAGGGCGCCCAGG + Intronic
1175942124 20:62542273-62542295 CAACAGGGCCCTGGGGGCCCAGG - Intergenic
1176144042 20:63557612-63557634 CCACAGCGGCCAGGGGGTCCTGG + Intergenic
1176203540 20:63875623-63875645 CCACAGCTCACCTGGCGGCCTGG + Intronic
1176247004 20:64102215-64102237 CCGCAGCGCCCCGGGGCCCAAGG - Intergenic
1176380621 21:6110791-6110813 CCGCAGTGCCCCCAGCGCCCGGG + Intergenic
1176618550 21:9040590-9040612 GCACTGCGCCCCGGGGACCCTGG - Intergenic
1176715193 21:10343771-10343793 CCCCAGCGGCCCGTGCGCCCCGG - Intergenic
1176796011 21:13371762-13371784 CCACAGTGCCCGGGGCTCCCTGG + Intergenic
1176887491 21:14273914-14273936 CCGCACCGCCCCAGGCGCACTGG + Intergenic
1176993148 21:15522313-15522335 CCACAGAGCCCATGGCGCCCAGG + Intergenic
1179603346 21:42496007-42496029 CCACAGCTCCCCAGGATCCCCGG - Intronic
1179626798 21:42653656-42653678 CCACCGGGCCCGGGACGCCCGGG - Intronic
1179742851 21:43427449-43427471 CCGCAGTGCCCCCAGCGCCCGGG - Intergenic
1179879733 21:44288403-44288425 CCACGGCCCCTCGGGCTCCCGGG - Exonic
1180092541 21:45540398-45540420 CCCCAGGGGCCCGGGAGCCCTGG + Intronic
1180225474 21:46389438-46389460 CCACAGGACCCCGGGAGCCTGGG - Intronic
1180226155 21:46393662-46393684 CCACAGGGCCCCGGCCTCACCGG - Intronic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1182355343 22:29720244-29720266 CCCCCGCGCCCCGGGCCGCCGGG - Exonic
1182359799 22:29739827-29739849 CCACAGCACCACTGGCTCCCAGG + Intronic
1184493764 22:44825626-44825648 CCACAGCTCCCAGGGCTCCAGGG - Intronic
950446384 3:13041245-13041267 CCACAGCGCTCAGGGCCCACTGG + Intronic
950465037 3:13148671-13148693 CCACAGTCCCCGGGGCTCCCTGG + Intergenic
950683980 3:14603205-14603227 CCATCCCGCCCCCGGCGCCCGGG - Intergenic
953099235 3:39809416-39809438 CCAGAGCACCTCGGGCGCGCGGG - Intronic
953705126 3:45225461-45225483 CCACAGCGGCCCGGGCGGCTCGG + Exonic
954367817 3:50155523-50155545 CCGCCGCCGCCCGGGCGCCCAGG + Exonic
956678249 3:71754580-71754602 CGACGGCGCCCCCGGCGCGCTGG + Exonic
959539459 3:107523401-107523423 CCTCAGCGCCCCCCGCCCCCCGG - Intronic
961780798 3:129319114-129319136 CCACGGTGCCCCGGGGGACCTGG + Intergenic
962240409 3:133746860-133746882 CTACAGCTCCCAGGGCACCCAGG - Intronic
963253315 3:143120907-143120929 CCGCAGTGGCCCCGGCGCCCAGG + Exonic
968230784 3:197003435-197003457 CCCCAGCGGCCCCGGCGCCCGGG - Exonic
969285376 4:6199547-6199569 CCAGTGCGCCCAGGGCGCGCCGG + Intronic
969687340 4:8683068-8683090 CCTCAGCTCCCCTGGCCCCCAGG + Intergenic
973954504 4:56049390-56049412 CCGCAGCGCCCCGGGACTCCAGG + Intergenic
979468785 4:121071631-121071653 CCACTGCACCCCGAGCTCCCGGG + Intronic
984734951 4:183099682-183099704 CCCCAGCCCCCCGCGCGGCCGGG - Intronic
985448400 4:190041207-190041229 CCACAGCCCCGGGGGCGCGCGGG - Intergenic
985520315 5:371063-371085 CCCCAGCGCCCCTGGCCCTCAGG - Intronic
985655503 5:1129542-1129564 CCACAGCGTCCCAGGCGACAGGG + Intergenic
985936449 5:3101386-3101408 CCCCAGCCCCCCGGAAGCCCAGG + Intergenic
990308696 5:54518156-54518178 AGACGGCGGCCCGGGCGCCCCGG + Exonic
990995965 5:61732423-61732445 CCACAGCGCCCCGCGCAAGCAGG - Intronic
993727159 5:91381097-91381119 AGACCCCGCCCCGGGCGCCCGGG - Intronic
995733001 5:115265459-115265481 CCAGAGCCCCCCGGGCCTCCGGG + Intergenic
996329411 5:122312262-122312284 CGCCGGCGCGCCGGGCGCCCCGG + Exonic
997965383 5:138352575-138352597 GCACAGCGCCCCCCGCGCTCTGG - Exonic
1001525199 5:172423928-172423950 CCACCGCGCCCGGCCCGCCCTGG + Intronic
1001942519 5:175750723-175750745 CCCCAGCACCCCGGGCGGCAGGG + Intergenic
1002724102 5:181283153-181283175 CCACAGTGCCCAGGGCTCACTGG - Intergenic
1002991767 6:2245377-2245399 CCCCAGCGCCCGGGGCTCCGGGG - Exonic
1003074422 6:2971182-2971204 CCCGAGGACCCCGGGCGCCCAGG - Intronic
1006449772 6:34099241-34099263 CCACAGCTCCCCTGGCTCCCAGG - Intronic
1007570961 6:42890621-42890643 CCACAGCGTCCCGGCTGCCGCGG - Exonic
1013170739 6:107634725-107634747 CGGCAGCCCCCCGGGCCCCCCGG + Exonic
1013288131 6:108698103-108698125 CCAGAGTGCCCCTGGCACCCTGG - Intergenic
1018091335 6:160348660-160348682 CCAGAGCCCCCCGAGCGCCGCGG + Exonic
1019145086 6:169971120-169971142 CCACAGAGCCCCGGCAACCCCGG + Intergenic
1019275541 7:173649-173671 CCTCAGAGCCCCGGGCCCCATGG - Intergenic
1019421947 7:954694-954716 CCAGAGCGCAGCGTGCGCCCCGG - Intronic
1019487000 7:1294037-1294059 CCACAGCCCCTCGGGGGCCAAGG - Intergenic
1019534946 7:1523931-1523953 CCACCCCTCCCGGGGCGCCCCGG + Intergenic
1019625545 7:2014037-2014059 CCACAGGGAGCTGGGCGCCCTGG + Intronic
1020099977 7:5389130-5389152 CCTCCTCGCCCCGGGCGCGCGGG + Exonic
1022089160 7:27096515-27096537 ACACCGCGCCCCGGGTTCCCAGG + Intergenic
1023221130 7:37920960-37920982 CCGCACCGTCCCGGGCGCCCTGG + Exonic
1024058542 7:45681922-45681944 CCACACTGCCCTGGGCACCCTGG - Intronic
1026840509 7:73667995-73668017 CCAAAGCGCCCCGGGCTGCCGGG - Exonic
1029496345 7:100897079-100897101 CCGCAGCGCCTCGGGCACGCGGG + Intergenic
1034535924 7:151725742-151725764 CCTCAGCACCCGGGGCCCCCAGG + Intronic
1034680762 7:152925760-152925782 CCACAGCTCCGCGGGCCTCCGGG - Intergenic
1034844534 7:154431931-154431953 CCACAGAGCCCAGGGCTACCAGG - Intronic
1035295866 7:157866861-157866883 CCACCCCGCCCCCGACGCCCTGG + Intronic
1035295879 7:157866895-157866917 CCACCCCGCCCCCGACGCCCTGG + Intronic
1035295892 7:157866929-157866951 CCACCCCGCCCCCGACGCCCTGG + Intronic
1035295932 7:157867047-157867069 CCACCCCGCCCCTGACGCCCTGG + Intronic
1035295944 7:157867081-157867103 CCACCCCGCCCCTGACGCCCTGG + Intronic
1035295967 7:157867149-157867171 CCACCCCGCCCCTGACGCCCTGG + Intronic
1035295979 7:157867183-157867205 CCACCCCGCCCCTGACGCCCTGG + Intronic
1035296034 7:157867353-157867375 CCACCCCGCCCCTGACGCCCTGG + Intronic
1036032823 8:4992125-4992147 CCGCAGGGCCCGAGGCGCCCAGG + Intronic
1036638871 8:10569683-10569705 TCACAGAGTCCCGGGAGCCCAGG - Intergenic
1037819913 8:22130585-22130607 CTAGAGCGCCCCCGCCGCCCCGG - Exonic
1037966114 8:23135193-23135215 CCACAGCTCCCAGGAGGCCCAGG - Intergenic
1038267909 8:26050371-26050393 AAGCAGCGCCCCGCGCGCCCGGG + Intergenic
1038421258 8:27435562-27435584 CCACAGAGCCCAGGGCACCTTGG - Intronic
1041910738 8:63086042-63086064 CCGCAGCTACCCGGGCACCCGGG + Exonic
1044858114 8:96495432-96495454 CGACAGAGCTCCTGGCGCCCAGG - Intronic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1046956645 8:120069160-120069182 CCACAGCACCCTGGGCACCTTGG + Intronic
1049166391 8:141128600-141128622 TCGCAGCGCCCCCGGCCCCCAGG + Exonic
1049210953 8:141386193-141386215 CCTCAGCACCCAGGGCTCCCAGG - Intergenic
1049220182 8:141425493-141425515 CAACAGGGCCCCAGCCGCCCAGG - Intronic
1049446077 8:142632268-142632290 CTCCAGCGCCCCGGCGGCCCTGG - Intergenic
1049671159 8:143870457-143870479 CCACAGCTCCCAGGCCGCACAGG + Exonic
1049762937 8:144339027-144339049 CCGCAGCCCCCCGGGACCCCTGG + Intergenic
1049891329 9:73321-73343 CCACCGCGCCCCGCGAGCACCGG - Intergenic
1053886240 9:42646587-42646609 CCACAGTGCCCGGGGCTCCTTGG - Intergenic
1054225260 9:62454036-62454058 CCACAGTGCCCGGGGCTCCTTGG - Intergenic
1055308245 9:74952356-74952378 CAACAGCGCCCCGAGCGGCCAGG - Exonic
1056684304 9:88746921-88746943 CCTCAGAGCCCCGGGTGGCCTGG - Intergenic
1057139103 9:92716119-92716141 CCTCACCGCCCTGGGAGCCCTGG - Intronic
1057489645 9:95511136-95511158 CCGCAGCCCCCAGCGCGCCCGGG - Intronic
1059375254 9:113876228-113876250 CCCCAGCGCCCCCGCCCCCCCGG + Intergenic
1059647474 9:116281649-116281671 CCACAGCACCCCTGGCTACCAGG + Intronic
1060208954 9:121699007-121699029 CCCGAGCCCCCCGGGCGCCGGGG - Intronic
1060485819 9:124045611-124045633 CGACAGCTCCCCGGGGGCTCGGG - Intergenic
1060544816 9:124453603-124453625 CCGCTGGGACCCGGGCGCCCTGG + Exonic
1060583135 9:124770281-124770303 CCTCAACGCCCCGCGCGCTCTGG - Intronic
1060964564 9:127705532-127705554 CCACAGCCCCTCGGGCAGCCTGG - Intronic
1061365933 9:130172505-130172527 GCCCCACGCCCCGGGCGCCCCGG + Intergenic
1061843820 9:133375860-133375882 CCGGAGCGGCCCGGGCGGCCTGG + Intronic
1061921282 9:133783805-133783827 ACACAGCATCCCGGGCACCCAGG + Intronic
1061961908 9:133992810-133992832 CCCCTGCGCCCCCAGCGCCCCGG - Intergenic
1062019001 9:134307428-134307450 CCACAGGGCCCTGGCTGCCCGGG + Intergenic
1062026296 9:134342263-134342285 CCACAGTGCACCAGGTGCCCCGG + Intronic
1062469480 9:136696293-136696315 CCGAGGGGCCCCGGGCGCCCAGG + Intergenic
1185508339 X:644737-644759 CCACCGTGCTCCGGGCACCCCGG + Exonic
1187029462 X:15470888-15470910 CCACCGCGCCCAGCGCACCCCGG + Intronic
1187281291 X:17860477-17860499 CGTCGGCGCCCCGGGAGCCCCGG - Intronic
1196822361 X:119712123-119712145 CCACAGGGCCCTGAGAGCCCAGG - Intergenic
1200292591 X:154886737-154886759 CGCCAGCGCCCTGGGCGCCGCGG + Exonic
1200339435 X:155382477-155382499 CGCCAGCGCCCTGGGCGCCGCGG + Exonic
1200347035 X:155458216-155458238 CGCCAGCGCCCTGGGCGCCGCGG - Exonic
1202048361 Y:20756369-20756391 CAACAGCACCACCGGCGCCCAGG - Intronic