ID: 1084542650

View in Genome Browser
Species Human (GRCh38)
Location 11:69797185-69797207
Sequence AAAGAGCCAGCCTGGCGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084542650_1084542655 30 Left 1084542650 11:69797185-69797207 CCACGGCGCCAGGCTGGCTCTTT No data
Right 1084542655 11:69797238-69797260 TGTCAGCCGCACAGACCCAAGGG No data
1084542650_1084542652 7 Left 1084542650 11:69797185-69797207 CCACGGCGCCAGGCTGGCTCTTT No data
Right 1084542652 11:69797215-69797237 ACATTGTGTGAGTGCCTCACTGG No data
1084542650_1084542654 29 Left 1084542650 11:69797185-69797207 CCACGGCGCCAGGCTGGCTCTTT No data
Right 1084542654 11:69797237-69797259 GTGTCAGCCGCACAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084542650 Original CRISPR AAAGAGCCAGCCTGGCGCCG TGG (reversed) Intergenic
No off target data available for this crispr