ID: 1084542655

View in Genome Browser
Species Human (GRCh38)
Location 11:69797238-69797260
Sequence TGTCAGCCGCACAGACCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084542651_1084542655 22 Left 1084542651 11:69797193-69797215 CCAGGCTGGCTCTTTGTTGCTTA No data
Right 1084542655 11:69797238-69797260 TGTCAGCCGCACAGACCCAAGGG No data
1084542650_1084542655 30 Left 1084542650 11:69797185-69797207 CCACGGCGCCAGGCTGGCTCTTT No data
Right 1084542655 11:69797238-69797260 TGTCAGCCGCACAGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084542655 Original CRISPR TGTCAGCCGCACAGACCCAA GGG Intergenic