ID: 1084542920

View in Genome Browser
Species Human (GRCh38)
Location 11:69798481-69798503
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084542920_1084542930 12 Left 1084542920 11:69798481-69798503 CCATGTGCCCGGTGAGGGCCCCT No data
Right 1084542930 11:69798516-69798538 TTAACCGAGTGCCCCAGGAAAGG No data
1084542920_1084542928 7 Left 1084542920 11:69798481-69798503 CCATGTGCCCGGTGAGGGCCCCT No data
Right 1084542928 11:69798511-69798533 CCTCCTTAACCGAGTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084542920 Original CRISPR AGGGGCCCTCACCGGGCACA TGG (reversed) Intergenic
No off target data available for this crispr