ID: 1084543326

View in Genome Browser
Species Human (GRCh38)
Location 11:69800773-69800795
Sequence CACTGCGCTCGGCTTGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084543326_1084543329 5 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543329 11:69800801-69800823 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1084543326_1084543337 22 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543337 11:69800818-69800840 CTTTGGGATGCCGAGGCGGGTGG 0: 194
1: 40922
2: 125443
3: 196844
4: 145847
1084543326_1084543330 6 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543330 11:69800802-69800824 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1084543326_1084543333 15 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543333 11:69800811-69800833 CCCAGCACTTTGGGATGCCGAGG 0: 658
1: 120723
2: 270110
3: 212846
4: 125773
1084543326_1084543336 19 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543336 11:69800815-69800837 GCACTTTGGGATGCCGAGGCGGG 0: 451
1: 88770
2: 228020
3: 236756
4: 154542
1084543326_1084543335 18 Left 1084543326 11:69800773-69800795 CCTAAGACAAGCCGAGCGCAGTG No data
Right 1084543335 11:69800814-69800836 AGCACTTTGGGATGCCGAGGCGG 0: 472
1: 92603
2: 189549
3: 137068
4: 71545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084543326 Original CRISPR CACTGCGCTCGGCTTGTCTT AGG (reversed) Intergenic
No off target data available for this crispr