ID: 1084545812

View in Genome Browser
Species Human (GRCh38)
Location 11:69814586-69814608
Sequence AGGAGTGCTGTCCCACCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084545812_1084545822 16 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545822 11:69814625-69814647 CGCAGGACTGTGGTATCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 108
1084545812_1084545823 20 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545823 11:69814629-69814651 GGACTGTGGTATCAGGTGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1084545812_1084545821 13 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545821 11:69814622-69814644 GCACGCAGGACTGTGGTATCAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1084545812_1084545819 6 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545819 11:69814615-69814637 GCTGGCCGCACGCAGGACTGTGG 0: 1
1: 0
2: 0
3: 16
4: 124
1084545812_1084545825 27 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545825 11:69814636-69814658 GGTATCAGGTGGCAGGTGGCAGG 0: 1
1: 0
2: 3
3: 36
4: 414
1084545812_1084545824 23 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545824 11:69814632-69814654 CTGTGGTATCAGGTGGCAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 274
1084545812_1084545818 -1 Left 1084545812 11:69814586-69814608 CCCCGTGGTGGGACAGCACTCCT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1084545818 11:69814608-69814630 TAGGCAAGCTGGCCGCACGCAGG 0: 1
1: 0
2: 1
3: 7
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084545812 Original CRISPR AGGAGTGCTGTCCCACCACG GGG (reversed) Intronic
901374284 1:8826387-8826409 AGGAGAGCTGTCACACCCCTGGG - Intergenic
904081721 1:27876612-27876634 ATGAGTGCTGCCTCTCCACGGGG + Exonic
905009344 1:34736677-34736699 AGGAGTGTTGCCCCACCCCTGGG - Intronic
906083069 1:43107348-43107370 AGGAGTGCGGGCGCACCGCGTGG - Intergenic
907872467 1:58455381-58455403 AGGATTGCAGGCCCACCCCGCGG + Intronic
913007799 1:114651916-114651938 AGGAGTGCAGTCCCACAGAGGGG + Intronic
918581079 1:186130551-186130573 AGGATTGCATTCCCACCAAGTGG - Exonic
919049726 1:192499087-192499109 AGGAGTGCGGGAGCACCACGTGG - Intergenic
923101661 1:230822230-230822252 ATGAGTGCTTTTCCACCACATGG - Intergenic
923519238 1:234723182-234723204 AGGAGTCCTGTCCCACCCGCAGG + Intergenic
1068554893 10:58448250-58448272 AGGAGTGCTGGCGCACAGCGCGG - Intergenic
1069993043 10:72326329-72326351 AGGAGTGCGGGCCCACAGCGCGG + Intergenic
1070942499 10:80359482-80359504 AGGAGTGCGGGCACACTACGTGG - Intronic
1070968373 10:80543589-80543611 AGGAGTGCGGGCGCACCGCGCGG + Intronic
1073633129 10:105168886-105168908 AGGAGCGCTCTCCCACCTCAAGG + Intronic
1075838718 10:125478803-125478825 AGGAGAGCTGTGCCACCCCAGGG + Intergenic
1075960019 10:126560450-126560472 GGCAGTCCTGTCCCACCACCAGG + Intronic
1076237693 10:128878203-128878225 AGGAAGGCTGTTCCACCAGGTGG + Intergenic
1076545120 10:131240071-131240093 AGGGGTCGTGTCCCACCACAGGG - Intronic
1077548900 11:3190720-3190742 AGGAGTGCTGTGTCCTCACGGGG + Intergenic
1077895848 11:6452661-6452683 ATGAGTGCTGTCCTGCCACAGGG - Intronic
1078006491 11:7536298-7536320 ATGAGTGACGTCCCACCACTGGG + Intronic
1084545812 11:69814586-69814608 AGGAGTGCTGTCCCACCACGGGG - Intronic
1088735799 11:112726765-112726787 AGGAGAGCTGTCAGACCACAAGG - Intergenic
1092145439 12:6211424-6211446 AGGAGGGCCGTTCCACCAAGCGG + Intronic
1093793787 12:23286303-23286325 AGGAGTGCAGACCCACGGCGCGG + Intergenic
1095304203 12:40620987-40621009 AGGAGTGCGGGCGCACCGCGCGG + Intergenic
1100297211 12:93274210-93274232 AGGACTTCTGTCCCACCCTGGGG + Intergenic
1100315512 12:93441584-93441606 GGGAGTGCTGTCCCACGCCCCGG - Intronic
1101586049 12:106087043-106087065 GGGCGTGCTGTCCCGCCAGGTGG + Intronic
1101966915 12:109287921-109287943 ATGAGGGCTGGCCCCCCACGGGG + Exonic
1113776384 13:112948041-112948063 AGGAGTGCTGTGCCAGAATGTGG + Intronic
1115701435 14:35956981-35957003 AGCTGTGCTGCCCCACCACAGGG - Intergenic
1115892116 14:38042577-38042599 AGGATTCGTGTCCCACCACAGGG - Intergenic
1117800594 14:59440464-59440486 AGGACTGCTGTTCCACAATGGGG - Intronic
1119773097 14:77233659-77233681 AAGAGTCCTGCCCCACCAAGAGG - Intronic
1123799209 15:23803289-23803311 AGGAGTGCTGGCACACGGCGAGG + Intergenic
1124819171 15:33026872-33026894 TGGAGTACTTTTCCACCACGTGG - Intronic
1126797374 15:52270950-52270972 AGGAGAGCTGTGACAGCACGGGG + Intronic
1130447361 15:84015641-84015663 GGCAGTGGTGTGCCACCACGTGG + Intronic
1131992323 15:98104250-98104272 AGGAGTGCAGGCCCACGGCGCGG - Intergenic
1135280924 16:21152973-21152995 AGGAGTGCGGGCCCACGGCGCGG + Intronic
1137694962 16:50455418-50455440 AAGAGAGTTGTCCCACCAAGGGG - Intergenic
1139806290 16:69566926-69566948 AGGGGGGCTGTCCCAACATGGGG - Intronic
1143334884 17:6164846-6164868 GGGAATGCTGTCCCAAAACGTGG - Intergenic
1143515659 17:7418081-7418103 AGGTGTGCTTTCTCACAACGGGG + Exonic
1144726958 17:17506902-17506924 GGGGCTGCTGTCCCACCACCTGG - Intronic
1145107197 17:20128436-20128458 AGGAGTGCTGTCAGATCACAAGG + Intronic
1145979241 17:29002154-29002176 AGGAATGCTGTGCCCCCACCTGG - Intronic
1146621826 17:34404687-34404709 TGGGGTCCTGTCCAACCACGGGG + Intergenic
1154503234 18:15006811-15006833 AGGACTGCTGTCCCATTACAGGG - Intergenic
1156150378 18:34234219-34234241 AGGAGTGCGGGCCCACGGCGCGG + Intergenic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1160463367 18:79056058-79056080 ATGAGTGCTGTGCCCTCACGTGG - Intergenic
1161130170 19:2583745-2583767 AGGAGTGCAGTGCCACCATCAGG - Intronic
1163724598 19:18915508-18915530 AGCAATGCTCTCCCACCCCGGGG - Intronic
1164742263 19:30584456-30584478 AGGAGTGCTGTAGCACCGCAGGG - Intronic
1165469049 19:35992882-35992904 AGAAGTGCTGTCTCCCCACTGGG - Intergenic
1167841437 19:52124881-52124903 AGGAATGCTGTGTCCCCACGTGG + Intronic
925415049 2:3664083-3664105 AAGAGAGATGTCCCACCACAAGG - Intronic
925665677 2:6252716-6252738 AGCAGTGCTGTCCCTCCTCCAGG + Intergenic
926437603 2:12854066-12854088 AGGAGTGCGGGCGCACCACGTGG - Intergenic
927027699 2:19086595-19086617 AGGGGCTCTGTCCCACCAAGTGG + Intergenic
927357138 2:22186674-22186696 AGGAGTGGGGGCCCACCGCGCGG + Intergenic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
937543505 2:122988528-122988550 AGCAGTGCTGTCCCACAAAAAGG + Intergenic
938502413 2:131836972-131836994 AGGACTGCTGTCCCATTACAGGG - Intergenic
940229815 2:151438921-151438943 AGGTGTGCTGACCCACCACATGG + Intronic
944511453 2:200470092-200470114 AGGTGTGCAGTCCCCCCAGGGGG + Intronic
944603899 2:201332084-201332106 AAGAGTGCTGTCTCTCCACCAGG + Intronic
947855285 2:233319754-233319776 AGGACAGCTGTCAAACCACGTGG + Intronic
948062078 2:235049479-235049501 AGGTGTGCTGGACCACCACAGGG - Intronic
948850764 2:240704287-240704309 AGCAGAGTCGTCCCACCACGGGG + Intergenic
948899252 2:240947863-240947885 TGGAGGCCTGGCCCACCACGGGG - Intronic
1169015643 20:2290614-2290636 AGGAATGGTGGCCCACCACATGG + Intergenic
1169431929 20:5544134-5544156 AGGTGTGCTGTCCCAGGAAGAGG + Intergenic
1169787575 20:9376577-9376599 AGTAGTAGTGTCTCACCACGTGG - Intronic
1172222210 20:33281741-33281763 AGCTTTGCTGTCCCAGCACGTGG + Intronic
1173579984 20:44140371-44140393 TGGAGCTCTGACCCACCACGTGG - Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176367548 21:6043106-6043128 AGGAGTGCTGTGGCGCCCCGCGG + Intergenic
1176369577 21:6054162-6054184 TGGAGAGCTCTCCCACCAGGAGG + Intergenic
1176653503 21:9570622-9570644 AGGACTGCTGTCCCATTACAGGG - Intergenic
1179753942 21:43484379-43484401 TGGAGAGCTCTCCCACCAGGAGG - Intergenic
1179755971 21:43495436-43495458 AGGAGTGCTGTGGCGCCCCGCGG - Intergenic
1183617368 22:38953875-38953897 AGGAGGGGCGTCCCACCTCGTGG - Intronic
1185382993 22:50518693-50518715 AGGAGCCCTGTCCCAGCACTCGG + Exonic
1185402971 22:50627953-50627975 AGGAGTTCCGTCCCAGCCCGCGG - Exonic
949957792 3:9283903-9283925 AGAAGGGCTGTCCCTCCACCAGG + Intronic
951024847 3:17817869-17817891 AGCAGTGCTGGCCCACCAGTGGG - Intronic
951146530 3:19234269-19234291 AGGAGTGCCGGCCCACAGCGCGG - Intronic
954295356 3:49671662-49671684 AGAAGTGCTGGCACAGCACGGGG + Intergenic
960669270 3:120140624-120140646 AGGAGTGCTGGCGCACTGCGCGG + Intergenic
961442160 3:126959586-126959608 AGCAGTGCTGCCCCACCCCAAGG - Intronic
967718422 3:192789408-192789430 AGGAGTGCGGGCCCACCGCACGG + Intergenic
968901149 4:3432548-3432570 AGGAGAACTGACCCCCCACGTGG - Intronic
972392620 4:38627279-38627301 AGGAGTGCGGGCGCACCGCGAGG + Intergenic
976661737 4:87546875-87546897 AGGTGTACTGTCCCACCTTGTGG + Intergenic
977127532 4:93188394-93188416 AGGAGTGCTGTTCCAGAATGGGG + Intronic
982086642 4:151842513-151842535 AGCAGTGCTGTCCAACTACCTGG + Intergenic
985668713 5:1195533-1195555 AGAAGTGCAGTCCCACTGCGTGG + Intergenic
988662801 5:33291745-33291767 AGGAGTCCAGTCTCACCAAGTGG + Intergenic
989003268 5:36782957-36782979 AGGAGTGCGGGCGCACCGCGCGG + Intergenic
993107124 5:83612115-83612137 AGGAGTGCTGTGCCAGAATGAGG - Intergenic
993297200 5:86155913-86155935 AGATGTGCTGACCCACAACGTGG - Intergenic
994507181 5:100657139-100657161 AGGAGTGCAGGCCCACCGCACGG + Intergenic
1000066102 5:157694215-157694237 AGGAGTGCAGGCGCACCACGCGG + Intergenic
1000889265 5:166784525-166784547 AGGAGTGCTGACCCACCACACGG - Intergenic
1001940834 5:175738393-175738415 AGGAGTGCTGTCCCAGTTCCTGG + Intergenic
1002317250 5:178351095-178351117 ATGAGTGCTGTGCCACCCCGCGG - Intronic
1003578256 6:7316807-7316829 AGGAGTGCTGGCGCACCGCGCGG - Intronic
1004452324 6:15758741-15758763 AGGAGTGCGGGCACACGACGTGG - Intergenic
1011353018 6:86444309-86444331 AGCAGTCCTGTCCCACCTCCAGG + Intergenic
1012519668 6:100106126-100106148 AGGAGTCCAGGCACACCACGTGG + Intergenic
1012986688 6:105883649-105883671 AGTAGTGCTGTCCCAGCTGGAGG + Intergenic
1015546938 6:134370948-134370970 AGGGGTACTATCCCACCACCTGG - Intergenic
1017819487 6:158038976-158038998 AGGAATGCTGACCCCCCACCAGG - Intronic
1018262152 6:161980808-161980830 ATGACTGCTGCACCACCACGAGG + Intronic
1037608871 8:20459628-20459650 GGGGGTGCTGTCCCTCCAGGTGG - Intergenic
1039340129 8:36639009-36639031 AGGAGTGCTGACTCCCCACATGG - Intergenic
1041068601 8:54104572-54104594 AGGAGTGCAGGCCCACGGCGTGG + Intergenic
1048299570 8:133241302-133241324 AGAAGTGCTGTCCCAGGACTAGG - Intronic
1050555845 9:6789139-6789161 AGGACTGCTTTACCACCCCGGGG - Intronic
1050605498 9:7296965-7296987 ATGAGTGCTGTCCCAGACCGAGG + Intergenic
1057260475 9:93580226-93580248 TGGAGTGCTGTCCCAGAATGTGG + Intronic
1058311941 9:103514886-103514908 AGGAGAGTTGGGCCACCACGCGG - Intergenic
1058462223 9:105193494-105193516 TGGAGTAATGTCCCACCCCGGGG - Intergenic
1060594167 9:124838717-124838739 AGGAGTGCGGGCGCACCGCGCGG - Intergenic
1061910349 9:133719106-133719128 GGAGGTGCTGGCCCACCACGGGG - Intronic
1062482014 9:136756912-136756934 GGGAGTGCTGGCCCACCAGCGGG + Intronic
1203631223 Un_KI270750v1:74069-74091 AGGACTGCTGTCCCATTACAGGG - Intergenic
1186295591 X:8144955-8144977 AGGAGTGCCGGCGCACCGCGTGG - Intergenic
1186623484 X:11266487-11266509 AGGACTGCTGTCCCACAAAGAGG - Intronic
1189800175 X:44684716-44684738 AGGACTGCTGTCACACTACAAGG + Intergenic
1191053850 X:56222588-56222610 AGGAGTGCAGGCCCACCATGTGG - Intergenic
1196056155 X:111357487-111357509 TGGAGTTCTGTCCCAGCACAGGG + Intronic
1198474242 X:136980531-136980553 AGGAGTGCTTTCCAACTATGTGG + Intergenic