ID: 1084546180

View in Genome Browser
Species Human (GRCh38)
Location 11:69816244-69816266
Sequence CACATCAAGCCAGGGGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1109
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 1070}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084546180_1084546191 24 Left 1084546180 11:69816244-69816266 CCCCCGTCCCCTGGCTTGATGTG 0: 1
1: 0
2: 1
3: 37
4: 1070
Right 1084546191 11:69816291-69816313 CGCCCACCCACGTGACAGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084546180 Original CRISPR CACATCAAGCCAGGGGACGG GGG (reversed) Intronic
900194133 1:1365548-1365570 CACTTGAACCCAGGGGGCGGAGG + Intergenic
900385844 1:2410307-2410329 CACACCAAGTCTGGGGACGGTGG - Intronic
900530167 1:3149140-3149162 CACAGCAAGCCTGGGGGTGGGGG + Intronic
900588997 1:3451196-3451218 CATACCAGGCCAGGGGACGCTGG - Intergenic
900998152 1:6133958-6133980 CGCATTATGCCAGGGCACGGGGG + Intronic
901089479 1:6631801-6631823 CACTTGAACCCAGGGGGCGGAGG + Intronic
901342433 1:8507489-8507511 CACTTGAACCCAGGGGGCGGAGG - Intronic
901454549 1:9355559-9355581 GACAGCTAGCCAGGGAACGGGGG + Intronic
901544894 1:9948731-9948753 CACATGAACCCAGGAGGCGGAGG - Intronic
901550062 1:9989372-9989394 CACTTCAACCCAGGAGGCGGAGG + Intergenic
901830598 1:11889652-11889674 CGCTTGAACCCAGGGGACGGAGG + Intergenic
902163267 1:14549688-14549710 CAAATCATGGCAGGGGGCGGAGG - Intergenic
902560285 1:17273105-17273127 CACAGCAAGACAGAGGCCGGAGG - Intronic
902601641 1:17543729-17543751 CACTTGAAACCAGGGGGCGGTGG - Intronic
903128699 1:21264396-21264418 CACTTGAACCCAGGAGACGGAGG - Intronic
903299552 1:22368885-22368907 CACTTGAACCCAGGAGACGGAGG + Intergenic
903379091 1:22884534-22884556 CACTTGAACCCAGGAGACGGAGG + Intronic
903397515 1:23013254-23013276 CACCTGAACCCAGGGGACTGAGG - Intronic
903789479 1:25882717-25882739 CACTTGAACCCAGGAGACGGAGG + Intergenic
904065591 1:27747834-27747856 CACTTGAAGCCAGGAGGCGGAGG + Intronic
904254574 1:29246697-29246719 CACTTGAACCCAGGGGGCGGAGG - Intronic
904491071 1:30859398-30859420 CACTTGAACCCAGGAGACGGAGG - Intergenic
904528264 1:31151005-31151027 CACTTGAACCCAGGAGACGGAGG - Intergenic
904528614 1:31154008-31154030 CACTTGAATCCAGGAGACGGAGG - Intergenic
904548058 1:31292276-31292298 CACTTGAACCCAGGAGACGGAGG + Intronic
904669529 1:32152930-32152952 CACATGAACCCAGGAGGCGGAGG + Intronic
905041006 1:34958449-34958471 CACATGAACCCAGGAGATGGAGG - Intergenic
905055789 1:35092314-35092336 CACTTCAACCCAGGAGGCGGAGG - Intronic
905920431 1:41715421-41715443 CACGGCAAGCCTGGGGAGGGTGG + Intronic
906227724 1:44135606-44135628 CACTTGAACCCAGGAGACGGAGG - Intergenic
906314444 1:44777153-44777175 CACTTCAACCCAGGAGGCGGAGG - Intronic
906492930 1:46281993-46282015 CACTTGAACCCAGGAGACGGAGG + Intronic
906568778 1:46818866-46818888 CACACCCAGCCTGGGGAGGGTGG - Exonic
906827182 1:48993846-48993868 CACATGATGCCAGGAGAAGGGGG + Intronic
907051487 1:51332342-51332364 CACTTGAACCCAGGAGACGGAGG - Intronic
907434045 1:54432538-54432560 CACTTGAACCCAGGAGACGGAGG + Intergenic
907468538 1:54655975-54655997 CACTTAAACCCAGGGGGCGGAGG - Intronic
907604658 1:55804669-55804691 CACATCAAGGCAGGGCCAGGTGG + Intergenic
907633569 1:56109011-56109033 CCCATGAACCCAGGAGACGGAGG + Intergenic
907658861 1:56373357-56373379 CTCTTGAACCCAGGGGACGGAGG - Intergenic
907740754 1:57163437-57163459 CAGAGCAAGCAAGGGGAAGGGGG + Intronic
908142808 1:61204667-61204689 CACATCAACCCAAGGGTGGGGGG - Intronic
908492513 1:64660612-64660634 CACCTGAACCCAGGAGACGGAGG - Intronic
908711802 1:67024026-67024048 CACTTGAACCCAGGAGACGGAGG - Intronic
908722876 1:67145261-67145283 CACTTGAACCCAGGAGACGGAGG + Intronic
909155955 1:72076976-72076998 CACTTGAACCCAGGGGGCGGAGG - Intronic
909587981 1:77312529-77312551 CACTTGAAGCCAGGAGGCGGAGG + Intronic
909642893 1:77887302-77887324 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
909809891 1:79919534-79919556 CACTTGAACCCAGGAGACGGAGG + Intergenic
910494343 1:87809891-87809913 CACTTGAACCCAGGGGGCGGAGG - Intergenic
910948757 1:92621833-92621855 TAAATCAAGGCAGGGCACGGTGG + Intronic
910965466 1:92803986-92804008 CACTTGAACCCAGGGGGCGGAGG - Intergenic
912078033 1:105901882-105901904 CACTTCAACCCAGGAGACAGAGG + Intergenic
913529443 1:119723176-119723198 AACATAAAGCCAGGGGAAGGGGG + Intronic
913706450 1:121429088-121429110 CACTTGAACCCAGGGGGCGGAGG - Intergenic
914681263 1:149939843-149939865 CACTTGAACCCAGGAGACGGTGG + Exonic
914832047 1:151177299-151177321 CACTTGAAGCCAGGAGGCGGAGG + Intronic
915112571 1:153573951-153573973 CACTTGAACCCAGGAGACGGAGG + Intergenic
915149827 1:153821648-153821670 CACTTGAACCCAGGAGACGGAGG - Intronic
915308768 1:154996687-154996709 CGCTTCAACCCGGGGGACGGAGG - Intergenic
915425582 1:155823807-155823829 CACTTGAACCCAGGAGACGGAGG + Intronic
915434690 1:155895362-155895384 CACTTGAACCCAGGGGGCGGAGG - Intergenic
915482052 1:156193747-156193769 CAAATCAAGGCCGGGCACGGTGG - Intergenic
915563770 1:156702686-156702708 CACTTGAATCCAGGAGACGGAGG + Intronic
915895535 1:159808628-159808650 CACATGTAGCCAGGGGAAGGAGG + Intronic
915920746 1:159973592-159973614 CACATGTAGCCAGGGGAAGGAGG - Intergenic
916341248 1:163738403-163738425 CACTTGAACCCAGGAGACGGAGG - Intergenic
916410891 1:164545926-164545948 CACTTGAACCCAGGAGACGGAGG - Intergenic
916529373 1:165641097-165641119 CACTTGAACCCAGGGGGCGGAGG + Intronic
916771787 1:167916288-167916310 CACTTCAACCCAGGAGGCGGAGG - Intergenic
917575254 1:176314519-176314541 CACTTCAACCCAGGAGACAGAGG - Intergenic
918034129 1:180849906-180849928 CACATCAAGAAAGGGGACCCAGG + Intronic
918297549 1:183171285-183171307 CACTTGAACCCAGGGGGCGGAGG - Intergenic
918303455 1:183224907-183224929 CACATCCAGCCAGGGGAGTCAGG - Intronic
918490503 1:185076372-185076394 CACTTAAAGCCAGGAGACGGAGG - Intronic
919041169 1:192390609-192390631 CACATGAACCCAGGAGGCGGAGG - Intergenic
919054165 1:192548756-192548778 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
919631582 1:199965095-199965117 CACTTGAACCCAGGAGACGGAGG - Intergenic
919649076 1:200127591-200127613 CACTTCAACCCAGGGGGCGGAGG + Intronic
919736059 1:200951888-200951910 CACATGAACCCAGGAGATGGAGG - Intergenic
919798018 1:201332858-201332880 AACATGAAGCAAGGGGAAGGTGG - Exonic
919865217 1:201776555-201776577 CGCTTGAACCCAGGGGACGGAGG + Intronic
919889056 1:201956870-201956892 CACTTGAACCCAGGAGACGGAGG + Intronic
919945611 1:202317426-202317448 CACTTGAACCCGGGGGACGGAGG - Intronic
920011061 1:202867965-202867987 CACTTGAACCCAGGAGACGGAGG + Intergenic
920058672 1:203212612-203212634 CACTTGAACCCAGGAGACGGAGG + Intergenic
920527457 1:206677830-206677852 CACTTGAACCCAGGAGACGGAGG - Intronic
920603113 1:207349264-207349286 CACTTGAACCCAGGAGACGGAGG - Intronic
920605549 1:207380615-207380637 CACTTGAACCCAGGGGGCGGAGG - Intergenic
921098145 1:211904937-211904959 CACTTGAAACCAGGAGACGGAGG - Intergenic
921154365 1:212427275-212427297 CACTTGAACCCAGGAGACGGAGG + Intergenic
921216843 1:212944966-212944988 CACTTGAACCCAGGAGACGGAGG + Intergenic
921625064 1:217370663-217370685 CACTTGAACCCAGGAGACGGAGG + Intergenic
921652979 1:217701056-217701078 CACTTCAACCCAGGAGGCGGAGG - Intronic
921869692 1:220126189-220126211 CACTTGAACCCAGGAGACGGAGG + Intronic
922673012 1:227528249-227528271 CACTTGAACCCAGGAGACGGAGG - Intergenic
922731610 1:227951328-227951350 CACTTGAACCCAGGGGGCGGAGG + Intergenic
922936243 1:229425256-229425278 CACTTGAACCCAGGAGACGGAGG + Intergenic
923399896 1:233606819-233606841 CACTTGAACCCAGGAGACGGAGG + Intergenic
923494231 1:234510654-234510676 CACTTGAACCCAGGGGGCGGAGG - Intergenic
923503881 1:234589273-234589295 CACAGAAAGCCAAGGGAGGGAGG - Intergenic
923578097 1:235179984-235180006 CACTTGAACCCAGGAGACGGAGG + Intronic
924104661 1:240638222-240638244 CACTTCAACCCAGGAGACAGAGG - Intergenic
924122617 1:240817684-240817706 CACTTGAACCCAGGAGACGGAGG - Intronic
924127721 1:240872993-240873015 CACATGAACCCAGGAGACAGAGG + Intronic
924230958 1:241961307-241961329 CACATGAACCCAGGAGGCGGAGG - Intergenic
924932527 1:248743379-248743401 CACTTGAACCCAGGAGACGGAGG + Intronic
1063414354 10:5861352-5861374 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1063650294 10:7929479-7929501 CACTTGAAGCCAGGAGATGGAGG - Intronic
1064352672 10:14590903-14590925 CACATGAATCCAGGAGGCGGAGG + Intronic
1064393572 10:14961552-14961574 CACTTGAACCCAGGAGACGGAGG - Intronic
1064432083 10:15279832-15279854 CGCTTCAACCCAGGAGACGGAGG + Intronic
1064487609 10:15812023-15812045 CACTTGAACCCAGGGGACGGAGG - Intronic
1065098195 10:22303707-22303729 CAAATCAAGGCCGGGCACGGTGG + Intergenic
1065369954 10:24973835-24973857 CACATGAACCCAGGGAGCGGAGG - Intergenic
1065575782 10:27116580-27116602 CACTTGAAGCCAGGAGACAGAGG + Intronic
1065668793 10:28091369-28091391 CACTTCAACCCAGGAGGCGGAGG - Intronic
1066071266 10:31816065-31816087 CACTTGAACCCAGGAGACGGAGG + Intronic
1066368188 10:34796899-34796921 CACTTGAACCCAGGAGACGGAGG + Intronic
1066395060 10:35012135-35012157 CACATGAACCCAGGAGATGGAGG - Intronic
1066425251 10:35302392-35302414 CACTTGAACCCAGGAGACGGAGG - Intronic
1066567811 10:36738443-36738465 CGCTTGAAGCCAGGGGACAGAGG + Intergenic
1067122299 10:43483950-43483972 CACTTGAAGCCAGGAGATGGAGG - Intergenic
1068288702 10:54972763-54972785 CACTTGAACCCAGGAGACGGAGG + Intronic
1068557968 10:58480133-58480155 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1069330575 10:67287252-67287274 CACTTGAACCCAGGAGACGGAGG + Intronic
1069423462 10:68268541-68268563 CACTTCAACCCAGGAGATGGAGG + Intergenic
1069808314 10:71139965-71139987 CACTTCAACCCAGGAGATGGAGG + Intergenic
1069926955 10:71857442-71857464 CATTTGAACCCAGGGGACGGAGG - Intergenic
1070141521 10:73741579-73741601 CGCTTGAACCCAGGGGACGGAGG - Intergenic
1070298884 10:75188403-75188425 CACAACAGCCCAGGGGAGGGAGG - Intergenic
1071479203 10:86050992-86051014 CACTTGAACCCAGGGGACAGAGG + Intronic
1072087387 10:92093936-92093958 CACTTGAACCCAGGAGACGGAGG - Intronic
1072121865 10:92411851-92411873 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1072242454 10:93509567-93509589 CACTTGAAACCAGGAGACGGAGG - Intronic
1072366792 10:94719656-94719678 CACTTGAACCCAGGAGACGGAGG - Intronic
1072490832 10:95904666-95904688 CAGATAAAGCCAGGGGAGGGAGG + Intronic
1072593470 10:96849155-96849177 CACTTGAAGCCAGGAAACGGAGG - Intronic
1072827116 10:98618539-98618561 CATATCAAGCCAGTGGAGAGTGG + Intronic
1072986358 10:100144412-100144434 CACTTGAACCCAGGAGACGGAGG - Intergenic
1073082452 10:100868633-100868655 GTCATCTAGCCAGGGGATGGGGG - Intergenic
1073184255 10:101606243-101606265 CACTTGAACCCAGGGGGCGGAGG - Intronic
1073351066 10:102820324-102820346 CACTTCAACCCGGGGGGCGGAGG - Intergenic
1074348239 10:112709451-112709473 CAGGTCAAGCGAGGGGAGGGTGG - Intronic
1074561349 10:114538382-114538404 CAGATAAAGACAGGGGAGGGTGG + Intronic
1074595728 10:114865069-114865091 CACTTGAACCCAGGGGGCGGAGG - Intronic
1074824827 10:117207110-117207132 CACTTGAACCCAGGGGGCGGAGG - Intronic
1075167422 10:120081443-120081465 CACATGAACCCAGGGGGCGGAGG + Intergenic
1075325707 10:121530536-121530558 CACTTGAACCCAGGAGACGGAGG + Intronic
1076390670 10:130099002-130099024 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1077076794 11:705831-705853 CCCAGCAGGCCGGGGGACGGGGG - Intronic
1077424367 11:2467414-2467436 TATATCAAGCCAGGGGACCAGGG - Intronic
1077641044 11:3881765-3881787 CACTTCAACCCAGGAGTCGGAGG - Intronic
1077894735 11:6445657-6445679 CACTTGAACCCAGGAGACGGAGG - Intergenic
1078351190 11:10595006-10595028 CACATGAACCCAGGAGCCGGAGG - Intronic
1078464979 11:11543551-11543573 CACAGCATGCCAGGGGCCAGGGG + Intronic
1078523241 11:12080451-12080473 CACTTGGAGCCAGGGCACGGAGG + Intergenic
1078599151 11:12715372-12715394 CAGATAAAGCCTGGGGACTGGGG + Intronic
1078776312 11:14396894-14396916 CACTTCAACCCAGGAGATGGAGG + Intergenic
1078836397 11:15034898-15034920 CAGAGCAAGGCAGAGGACGGAGG - Intronic
1079001698 11:16762970-16762992 CACTTGAACCCAGGAGACGGAGG + Intergenic
1079222824 11:18578949-18578971 CACTTAAACCCAGGAGACGGAGG - Intronic
1079910826 11:26307268-26307290 CGCTTCAACCCAGGAGACGGAGG + Intergenic
1080168720 11:29272553-29272575 CACTTAAACCCAGGAGACGGAGG - Intergenic
1080185319 11:29476382-29476404 CAAATCAAGCCTGGGCATGGTGG - Intergenic
1080354808 11:31431101-31431123 CACTTGAACCCAGGAGACGGAGG - Exonic
1080948356 11:37000077-37000099 CACGTGAGCCCAGGGGACGGAGG + Intergenic
1081548136 11:44087157-44087179 CACTTGAACCCAGGAGACGGAGG - Intergenic
1081557681 11:44181015-44181037 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1081635711 11:44720401-44720423 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1082043811 11:47708728-47708750 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1082130276 11:48480182-48480204 CAAATCAAGGCAGGGCACAGTGG - Intergenic
1082804528 11:57439245-57439267 CACATGAACCCAGGAGGCGGAGG - Intergenic
1083344792 11:61981790-61981812 CACATGAACCCAGGAGGCGGAGG + Intergenic
1083458506 11:62795390-62795412 CACTTGAACCCAGGAGACGGAGG + Intronic
1083772834 11:64878031-64878053 CCCATCACTCCAGGGGGCGGGGG - Intronic
1083826577 11:65207281-65207303 CACCTGAACCCAGGAGACGGAGG - Intronic
1083831040 11:65233693-65233715 CACTTGAACCCAGGAGACGGAGG + Intergenic
1083876673 11:65527646-65527668 CACTTGAACCCAGGAGACGGAGG + Intronic
1084126523 11:67102658-67102680 CACTTGAACCCAGGAGACGGAGG + Intergenic
1084199372 11:67545183-67545205 CACTTTAAGCCAGGAGACTGTGG - Intergenic
1084361028 11:68668760-68668782 CACTTGAACCCAGGAGACGGAGG - Intergenic
1084402316 11:68951783-68951805 CACTTCAAGCCAGGAGGTGGAGG - Intergenic
1084408394 11:68992058-68992080 CCCATCAAGGCCGGGCACGGTGG - Intergenic
1084530618 11:69725714-69725736 CACTTCAATCCAGGAGGCGGAGG + Intergenic
1084546180 11:69816244-69816266 CACATCAAGCCAGGGGACGGGGG - Intronic
1085029521 11:73261788-73261810 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1085233179 11:74990438-74990460 CACTTGAAACCAGGAGACGGAGG - Intronic
1085640967 11:78192445-78192467 CCCATCAGGCCAGGGAAGGGAGG - Intronic
1085663238 11:78389388-78389410 CACATCAACCCGGGAGGCGGAGG - Intronic
1086399346 11:86447772-86447794 CACTTGAACCCAGGGGGCGGAGG + Intronic
1086759547 11:90611175-90611197 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1086922315 11:92601509-92601531 CACTTCAACCCAGGAGATGGAGG + Intronic
1087019195 11:93585437-93585459 CACTTGAATCCAGGAGACGGAGG + Intergenic
1087441762 11:98193466-98193488 GTCATCAAGCGAGGGGAGGGTGG + Intergenic
1087759681 11:102092423-102092445 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1087760565 11:102100524-102100546 CACTTGAACCCAGGGGACAGAGG - Intergenic
1087835853 11:102873943-102873965 CACCTGAACCCAGGAGACGGAGG + Intronic
1088097866 11:106120891-106120913 CACTTCAACCCAGGAGACAGAGG - Intergenic
1088201130 11:107336228-107336250 CACTTCAACCCAGGAGGCGGAGG - Intronic
1088210384 11:107448259-107448281 CACTTCAACCCAGGAGGCGGAGG + Intronic
1088232516 11:107687513-107687535 CTCTTGAACCCAGGGGACGGAGG - Intergenic
1089135873 11:116248549-116248571 CACTTGAACCCAGGAGACGGAGG + Intergenic
1089165805 11:116475592-116475614 CACACCACGGCAGGGGGCGGGGG + Intergenic
1089390368 11:118097852-118097874 CACTTGAACCCAGGAGACGGAGG - Intronic
1089837828 11:121386884-121386906 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1090009482 11:123033514-123033536 CACTTGAACCCAGGAGACGGAGG + Intergenic
1090086678 11:123655870-123655892 CACTTGAACCCGGGGGACGGAGG - Intergenic
1090199394 11:124843410-124843432 CGCCTCAAGCCAGGGGCGGGGGG + Intergenic
1090769283 11:129905276-129905298 CACTTGAACCCAGGAGACGGAGG + Intronic
1091345858 11:134853500-134853522 CACTTGAACCCAGGAGACGGAGG + Intergenic
1091499470 12:1001942-1001964 CACTTGAACCCAGGAGACGGTGG - Intronic
1091603327 12:1930774-1930796 CACATGAAGCCAGAGGCAGGTGG + Intergenic
1092223834 12:6733528-6733550 CACTTCAACCCAGGAGACGGAGG - Intergenic
1092230548 12:6773406-6773428 CACCTCAGGGCAGGGGACAGAGG - Intronic
1092634630 12:10429577-10429599 CACTTTAAACCAGGGGTCGGAGG - Intronic
1092635672 12:10445001-10445023 CACTTCAAACCAGGGGTCGGAGG - Intronic
1092814794 12:12303586-12303608 CACTTGAACCCAGGTGACGGAGG - Intergenic
1092877533 12:12861503-12861525 CACTTGAACCCAGGAGACGGAGG - Intergenic
1092932349 12:13327951-13327973 CACCTGAAGCCAGGAGGCGGAGG + Intergenic
1092979460 12:13779125-13779147 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1093419520 12:18958674-18958696 CACCTGAACCCAGGAGACGGAGG + Intergenic
1093729364 12:22549988-22550010 CACTTGAACCCAGGAGACGGAGG - Intergenic
1093974575 12:25407280-25407302 CACTTGAAGCCAGGGGGCAGAGG - Intergenic
1094063843 12:26342691-26342713 CACTTGAATCCAGGGGGCGGAGG - Intronic
1094208846 12:27869267-27869289 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1094575178 12:31678478-31678500 CACTTGAACCCAGGAGACGGAGG - Intronic
1095255120 12:40025710-40025732 AACATCAAGCCTGGGAACTGTGG - Intronic
1095358774 12:41310014-41310036 CACTTGAAGCCAGGAGACAGAGG - Intronic
1095420967 12:42023122-42023144 CATAGCAAACCAGGGTACGGTGG - Intergenic
1095720072 12:45391035-45391057 CACTTGAACCCAGGAGACGGAGG + Intronic
1096210398 12:49760921-49760943 CACCTGAAGCCGGGAGACGGAGG - Intronic
1096415421 12:51408311-51408333 CACTTGAACCCAGGGGACGGAGG - Intronic
1096427131 12:51513536-51513558 CACTTGAAGCCAGGAGGCGGAGG - Exonic
1096493365 12:52025141-52025163 CACTTGAACCCGGGGGACGGAGG - Intronic
1096552644 12:52383456-52383478 CACATCAAGCCTGGGGAGGTGGG - Intronic
1096977946 12:55710275-55710297 CACTTAAACCCAGGAGACGGAGG + Intronic
1097222192 12:57457532-57457554 CACTTGAACCCAGGAGACGGAGG - Exonic
1097390948 12:59012221-59012243 CACTTGAACCCAGGAGACGGAGG - Intergenic
1097638533 12:62150820-62150842 CACTTGAACCCAGGAGACGGAGG + Intronic
1097799138 12:63893920-63893942 CACTTGAACCCAGGAGACGGAGG - Intronic
1097891088 12:64778638-64778660 CACATGAACCCAGGAGGCGGAGG - Intergenic
1098209172 12:68144701-68144723 CACATCAACCCAGGAGTCAGAGG + Intergenic
1098276562 12:68817879-68817901 CACTTGAACCCAGGAGACGGAGG - Intronic
1098361957 12:69663539-69663561 CAGATCAAGGCTGGGTACGGTGG + Intronic
1098538623 12:71624881-71624903 CGCTTCAACCCAGGAGACGGAGG + Intronic
1099006029 12:77235753-77235775 CACTTGAACCCAGGAGACGGAGG - Intergenic
1100100364 12:91096132-91096154 CACTTGAACCCAGGAGACGGAGG + Intergenic
1100127082 12:91440466-91440488 CACTTGAACCCAGGAGACGGAGG - Intergenic
1100264981 12:92967047-92967069 CACTTGAATCCGGGGGACGGAGG + Intergenic
1100296856 12:93270681-93270703 CACTTGAACCCAGGAGACGGAGG + Intergenic
1100297607 12:93277294-93277316 CACAGGAACCCAGGGGATGGAGG - Intergenic
1100319848 12:93480406-93480428 CAAATCAAGGCCGGGCACGGTGG - Intronic
1100396679 12:94191698-94191720 CACTTGAACCCAGGAGACGGAGG + Intronic
1100486741 12:95036592-95036614 CACTTGAATCCAGGAGACGGAGG - Intronic
1100734384 12:97511230-97511252 CACTTGAACCCAGGAGACGGAGG - Intergenic
1101221558 12:102646674-102646696 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1101483631 12:105129027-105129049 CACATGAACCCAGGAGGCGGAGG - Intronic
1101518631 12:105461123-105461145 CACAGCAAGCCAGGAAATGGTGG + Intergenic
1101773095 12:107769908-107769930 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1102898495 12:116617727-116617749 CACTTGAACCCAGGAGACGGAGG - Intergenic
1102967560 12:117139983-117140005 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1103085185 12:118057356-118057378 CACTTGAACCCAGGGGGCGGAGG - Intronic
1103093018 12:118111008-118111030 CACTTCAACCCAGGAGGCGGAGG + Intronic
1103093208 12:118112402-118112424 CACTTCAACCCAGGAGGCGGAGG - Intronic
1103205764 12:119127642-119127664 CACTTGAACCCAGGAGACGGAGG + Intronic
1103312999 12:120027112-120027134 CACATGAACCCAGGAGGCGGAGG - Intronic
1103348818 12:120268830-120268852 CACCTGAACCCAGGAGACGGAGG + Intergenic
1103411815 12:120717644-120717666 CACTTGAACCCAGGAGACGGAGG - Intronic
1103539279 12:121654679-121654701 CACTTGAACCCGGGGGACGGAGG - Intronic
1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG + Intronic
1103551689 12:121742667-121742689 CACTTGAACCCAGGGGGCGGAGG - Intronic
1104599107 12:130140369-130140391 TCCATCAGGCCAGGGGACTGGGG + Intergenic
1104678689 12:130733388-130733410 CACTTGAACCCAGGAGACGGAGG + Intergenic
1104803441 12:131570178-131570200 CACACCAAGGAAGGGGAAGGTGG - Intergenic
1105901383 13:24757405-24757427 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1106071339 13:26414169-26414191 CACTTGAACCCAGGAGACGGAGG + Intergenic
1106258630 13:28044364-28044386 CACTTGAACCCAGGAGACGGAGG + Intronic
1106694424 13:32156515-32156537 CACTTGAACCCAGGAGACGGAGG + Intronic
1106724128 13:32467339-32467361 CACTTGAACCCAGGAGACGGAGG - Intronic
1106786980 13:33117190-33117212 CACTTGAACCCAGGAGACGGAGG - Intronic
1106814522 13:33392481-33392503 CACTTGAATCCAGGAGACGGAGG - Intergenic
1106942063 13:34790531-34790553 CACTTGAACCCAGGAGACGGAGG + Intergenic
1107752674 13:43585659-43585681 CACTTGAACCCAGGAGACGGAGG - Intronic
1107858989 13:44642938-44642960 CACTTGAAGCCAGGAGCCGGAGG - Intergenic
1109373042 13:61449316-61449338 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1110212297 13:72987944-72987966 CACATAAACCCGGGGGGCGGAGG - Intronic
1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG + Intergenic
1110840406 13:80135510-80135532 CACTTGAACCCAGGGGGCGGTGG + Intergenic
1111522391 13:89423563-89423585 CACTTGAACCCAGGAGACGGAGG - Intergenic
1111906461 13:94261189-94261211 CACTTGAACCCAGGGGGCGGAGG + Intronic
1112254211 13:97814508-97814530 CACTTGAACCCAGGAGACGGAGG + Intergenic
1112275198 13:98011372-98011394 CACTTGAACCCAGGAGACGGAGG - Intronic
1112346561 13:98594885-98594907 CACATGAACCCAGGAGGCGGAGG + Intergenic
1112499871 13:99934638-99934660 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1112612714 13:100971594-100971616 CACTTGAACCCAGGAGACGGAGG - Intergenic
1112713664 13:102159054-102159076 CACTTGAACCCAGGGGATGGAGG + Intronic
1113485551 13:110650018-110650040 CACTTCAACCCAGGAGGCGGAGG - Intronic
1113974016 13:114212766-114212788 CACTTGAACCCAGGAGACGGAGG + Intergenic
1114326199 14:21591207-21591229 CACTTGAACCCAGGAGACGGAGG - Intergenic
1114472174 14:22970734-22970756 CACTTGAACCCAGGAGACGGAGG + Intronic
1115026371 14:28751571-28751593 GACTTGAAGCCAGGGTACGGTGG + Intergenic
1115244667 14:31282688-31282710 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1115501908 14:34057662-34057684 CACATTAAGGCTGGGCACGGTGG + Intronic
1115589088 14:34845775-34845797 CACTTGAACCCAGGAGACGGGGG + Intronic
1115616764 14:35102842-35102864 CACTTGAACCCAGGGGATGGAGG - Intronic
1115673949 14:35648211-35648233 CACTTGAACCCAGGAGACGGAGG + Intronic
1115982638 14:39070941-39070963 CACTTGAACCCAGGGGGCGGAGG + Intronic
1117469153 14:56024503-56024525 CACTTGAAGCCAGGAGACAGAGG + Intergenic
1117667212 14:58068921-58068943 CACTTGAACCCAGGAGACGGAGG + Intronic
1117773218 14:59155519-59155541 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1117817562 14:59613380-59613402 CACTTGAACCCAGGGGACAGAGG - Intronic
1117943642 14:60994918-60994940 CACTTCAACCCAGGTGATGGAGG + Intronic
1118027889 14:61789145-61789167 CACTTGAACCCAGGAGACGGAGG + Intronic
1118284626 14:64460572-64460594 CACTTGAACCCAGGAGACGGAGG - Intronic
1118831564 14:69438103-69438125 CACTTCAACCCAGGAGGCGGTGG - Intronic
1118869866 14:69732493-69732515 CACTTGAACCCAGGAGACGGAGG - Intronic
1119236011 14:73019865-73019887 CACTTGAACCCAGGAGACGGAGG + Intronic
1119355149 14:74000002-74000024 CACTTGAACCCAGGGGGCGGAGG + Intronic
1119403405 14:74379509-74379531 CACTTTAACCCAGGAGACGGAGG + Intergenic
1119497453 14:75092348-75092370 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG + Intergenic
1119731155 14:76951982-76952004 CACAAAAAGCCAAGGCACGGTGG - Intergenic
1119764433 14:77179523-77179545 CACTTGAACCCAGGAGACGGAGG - Intronic
1120985330 14:90329752-90329774 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1121754898 14:96394023-96394045 CACTTGAACCCAGGGGGCGGAGG + Intronic
1121908812 14:97770670-97770692 CACAGCAAGCCAGGAGTCTGTGG + Intergenic
1121950628 14:98167905-98167927 AACACCAACCCAGGTGACGGGGG - Intergenic
1122003729 14:98685149-98685171 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1122126765 14:99582728-99582750 CACTTGAAACCAGGGGGCGGAGG + Intronic
1122463129 14:101912115-101912137 AACATCTAACCAGGGGAAGGGGG + Intronic
1122525736 14:102382840-102382862 CACTTGAACCCGGGGGACGGAGG - Intronic
1122634279 14:103122990-103123012 CACAAGGAGGCAGGGGACGGGGG - Intergenic
1122678470 14:103437007-103437029 CACTTGAACCCAGGAGACGGAGG + Intronic
1122824991 14:104365960-104365982 CACTTGAACCCGGGGGACGGAGG - Intergenic
1122876798 14:104670773-104670795 CACTTGAACCCAGGAGACGGAGG + Intergenic
1122927508 14:104912963-104912985 CACTTGAACCCAGGAGACGGAGG - Intergenic
1123122881 14:105926296-105926318 CCCATCAAGCCAGGGCCAGGTGG - Intronic
1123405524 15:20017716-20017738 CCCATCAAGCCAGGGCCAGGTGG - Intergenic
1123514856 15:21024364-21024386 CCCATCAAGCCAGGGCCAGGTGG - Intergenic
1123677871 15:22729992-22730014 CACCTGAAGCCAGGAGACGAAGG - Intergenic
1123811090 15:23926846-23926868 CACTTGAGCCCAGGGGACGGGGG + Intergenic
1123909056 15:24949103-24949125 CACTTGAACCCAGGAGACGGAGG - Intronic
1124010296 15:25833064-25833086 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1124330071 15:28804259-28804281 CACCTGAAGCCAGGAGACGAAGG - Intergenic
1125209517 15:37196978-37197000 CACTTGAACCCAGGAGACGGAGG + Intergenic
1125214494 15:37254810-37254832 CACATCAAGGCTGGGTGCGGTGG - Intergenic
1125482382 15:40089502-40089524 AACATCAAGCCTGGGGCAGGTGG - Exonic
1125531077 15:40413942-40413964 CACTTGAACCCAGGGGGCGGAGG - Intronic
1125808554 15:42516411-42516433 CACTTGAACCCAGGAGACGGAGG - Intronic
1125838798 15:42778582-42778604 CACTTGAACCCAGGAGACGGAGG + Intronic
1126005379 15:44251738-44251760 CACTTGAACCCAGGAGACGGAGG + Intergenic
1126037076 15:44556588-44556610 CACTTCAACCCAGGAGGCGGAGG - Intronic
1126208936 15:46077918-46077940 CATACCAAGCCAAGGGACGATGG + Intergenic
1126487238 15:49195153-49195175 CACTTCAACCCAGGAGGCGGAGG - Intronic
1126584746 15:50272851-50272873 CACTTGAACCCAGGAGACGGAGG - Intergenic
1126588065 15:50310174-50310196 CACATGAACCCAGGAGGCGGAGG - Intronic
1126762039 15:51978214-51978236 CACTTGAACCCAGGAGACGGAGG - Intronic
1127011342 15:54633079-54633101 CACTTGAACCCAGGAGACGGAGG + Exonic
1127271727 15:57407830-57407852 CACTTGAACCCAGGAGACGGAGG - Intronic
1127327735 15:57911944-57911966 CACTTGAACCCAGGAGACGGAGG - Intergenic
1127523635 15:59770598-59770620 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1127573844 15:60271448-60271470 CACTTGAACCCAGGAGACGGAGG - Intergenic
1127621975 15:60743096-60743118 CACTTGAACCCAGGGGGCGGAGG - Intronic
1127996985 15:64158827-64158849 CCCCTCAGGCCAGGGAACGGGGG - Intronic
1128117149 15:65116504-65116526 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1128427468 15:67556633-67556655 CACTTGAATCCAGGGGGCGGAGG - Intronic
1128960069 15:71993264-71993286 CACTTGAACCCAGGAGACGGAGG + Intronic
1128960180 15:71994814-71994836 CACTTGAACCCAGGAGACGGAGG - Intronic
1128969391 15:72093801-72093823 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1129085806 15:73090276-73090298 CCCATGAACCCAGGAGACGGAGG - Intronic
1129096096 15:73209917-73209939 CACATGAACCCAGGAGGCGGAGG + Intronic
1129432176 15:75507360-75507382 CACTTGAACCCGGGGGACGGAGG + Intronic
1129755946 15:78099098-78099120 CACTTGAACCCAGGAGACGGCGG - Intronic
1129906072 15:79188154-79188176 CACTTGAACCCAGGAGACGGAGG - Intergenic
1130085481 15:80775244-80775266 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1130986958 15:88850858-88850880 CACCTCAACCCAGGAGGCGGAGG + Intronic
1130993268 15:88889417-88889439 CACTTGAACCCAGGAGACGGAGG - Intronic
1131136376 15:89939377-89939399 CACTTGAACCCAGGAGACGGAGG + Intergenic
1131187834 15:90291038-90291060 CACTTGAACCCAGGAGACGGAGG - Intronic
1131463418 15:92636228-92636250 CACTTGAACCCAGGAGACGGAGG + Intronic
1132737147 16:1392516-1392538 CACTTGAACCCAGGAGACGGAGG - Intronic
1132758630 16:1498096-1498118 CACTTGAACCCAGGAGACGGAGG - Intronic
1132768327 16:1546438-1546460 CAGATCACACCAGGGGAAGGGGG - Intronic
1133583294 16:7167067-7167089 CGCTTGAACCCAGGGGACGGAGG - Intronic
1133595655 16:7288755-7288777 CACTTGAACCCAGGGGATGGAGG + Intronic
1133649560 16:7798853-7798875 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1133785559 16:8970534-8970556 CACTTGAACCCAGGAGACGGAGG - Intergenic
1133790402 16:9005329-9005351 CGCTTGAAGCCAGGAGACGGAGG - Intergenic
1134031300 16:10994618-10994640 CACTTGAACCCAGGAGACGGAGG + Intronic
1134237828 16:12481616-12481638 CACTTGAACCCAGGAGACGGAGG - Intronic
1134438056 16:14279857-14279879 CACTTGAACCCAGGAGACGGAGG + Intergenic
1134507140 16:14817244-14817266 CACTTGAATCCAGGAGACGGCGG - Intronic
1134659699 16:15974868-15974890 CACTTGAACCCAGGAGACGGAGG - Intronic
1134682095 16:16133485-16133507 CACTTGAACCCAGGGGACGGAGG - Intronic
1134692528 16:16200343-16200365 CACTTGAACCCAGGGGGCGGAGG + Intronic
1134694840 16:16216001-16216023 CACTTGAATCCAGGAGACGGAGG - Intronic
1134979315 16:18594333-18594355 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1134998289 16:18756227-18756249 CACTTGAACCCAGGAGACGGAGG + Intergenic
1135021283 16:18965130-18965152 CACTTGAACCCAGGAGACGGAGG + Intergenic
1135114802 16:19715496-19715518 CACTTGAACCCAGGAGACGGAGG - Intronic
1135306978 16:21375863-21375885 CACTTAAAACCAGGAGACGGAGG - Intergenic
1135539794 16:23321123-23321145 CACTTGAACCCAGGAGACGGAGG - Intronic
1136158013 16:28398271-28398293 GACATCAAGGCTGGGCACGGTGG - Intronic
1136164138 16:28441382-28441404 CACTTGAACCCAGGAGACGGAGG + Intergenic
1136198827 16:28673600-28673622 CACTTGAACCCAGGAGACGGAGG - Intergenic
1136205074 16:28717012-28717034 GACATCAAGGCTGGGCACGGTGG + Intronic
1136215174 16:28787774-28787796 CACTTGAACCCAGGAGACGGAGG - Intergenic
1136249277 16:28993327-28993349 CACTTGAACCCAGGAGACGGAGG - Intergenic
1136259898 16:29067621-29067643 CACTTGAACCCAGGAGACGGAGG - Intergenic
1136303721 16:29355003-29355025 CACTTAAAACCAGGAGACGGAGG - Intergenic
1136391021 16:29964237-29964259 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1136464476 16:30432860-30432882 CACGTGAACCCAGGAGACGGAGG - Intergenic
1136484775 16:30564412-30564434 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1136494748 16:30635626-30635648 CCCATCCAGGCAGGGCACGGTGG + Intergenic
1137042999 16:35630901-35630923 CACATGAAACCAGGAGAAGGAGG - Intergenic
1137234229 16:46600723-46600745 CAGATCAAGGCTGGGTACGGTGG + Intronic
1137241969 16:46663463-46663485 CACTTGAATCCAGGAGACGGAGG - Intronic
1137248710 16:46727608-46727630 CACTTGAACCCAGGAGACGGAGG - Intronic
1137282370 16:46988952-46988974 CACTTGAACCCAGGAGACGGAGG - Intergenic
1137640411 16:50024193-50024215 CACTTGAACCCAGGAGACGGAGG - Intergenic
1137803823 16:51285405-51285427 CGCATGAACCCGGGGGACGGAGG + Intergenic
1138001976 16:53290188-53290210 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1138187955 16:54990917-54990939 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1138418527 16:56885052-56885074 CACATCAAGGCCAGGCACGGTGG - Intronic
1138548751 16:57735779-57735801 CCAATCAAGGCAGGGGATGGAGG + Exonic
1138643785 16:58407566-58407588 CACTTGAACCCAGGGGACAGAGG + Intergenic
1138657743 16:58500675-58500697 GCCATCAGGCCAGGGGGCGGGGG + Intronic
1139244296 16:65426337-65426359 CACTTGAACCCAGGAGACGGAGG + Intergenic
1139399806 16:66672319-66672341 CACTTGAACCCAGGAGACGGAGG + Intronic
1139405387 16:66713669-66713691 CACTTGAACCCAGGAGACGGAGG - Intergenic
1139920557 16:70457336-70457358 CACTTGAACCCAGGAGACGGAGG - Intronic
1139928763 16:70508002-70508024 CACTTCAACCCAGGAGGCGGAGG - Intronic
1140319372 16:73933895-73933917 CACTTGAACCCAGGAGACGGAGG - Intergenic
1140438729 16:74970005-74970027 CACTTGAACCCAGGAGACGGAGG - Intronic
1140526059 16:75623880-75623902 CGCTTGAAGCCAGGAGACGGAGG - Intergenic
1140673093 16:77298502-77298524 CACATCAAGGCCGGGCACGATGG + Intronic
1140680335 16:77378629-77378651 CACTTGAACCCAGGTGACGGAGG + Intronic
1140702341 16:77592657-77592679 CACTTGAACCCAGGAGACGGAGG - Intergenic
1141114133 16:81293754-81293776 CACGTGAACCCAGGGGGCGGAGG + Intergenic
1142294338 16:89210563-89210585 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1142327332 16:89424355-89424377 CACTTGAACCCAGGAGACGGAGG + Intronic
1142537601 17:630206-630228 CACTTGAACCCAGGGGGCGGAGG + Intronic
1142544141 17:687200-687222 CACTTGAACCCAGGAGACGGAGG + Intronic
1142761907 17:2047467-2047489 CACTTGAACCCAGGAGACGGAGG - Intergenic
1143170768 17:4928879-4928901 CACATGAACCCAGGAGGCGGAGG + Intergenic
1143251135 17:5524005-5524027 CACTTCAACCCAGGAGGCGGAGG - Intronic
1143252928 17:5536230-5536252 CACATGAACCCAGGAGACAGAGG - Intronic
1143404379 17:6667470-6667492 CGCTTGAACCCAGGGGACGGAGG + Intergenic
1143911713 17:10255760-10255782 CACTTGAACCCAGGAGACGGAGG - Intergenic
1143986498 17:10919225-10919247 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1144479356 17:15616256-15616278 CACTTGAACCCAGGAGACGGAGG - Intronic
1144778301 17:17795790-17795812 CACATGAAGCCAGGTGAAGAGGG + Exonic
1145189743 17:20828642-20828664 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1145220732 17:21086252-21086274 CACATGAACCCAGGAGGCGGAGG - Intergenic
1145811497 17:27766915-27766937 CACTTGAAGCCAGGAGACGGAGG + Intronic
1145920995 17:28609967-28609989 CACTTCAACCCAGGAGACGGAGG + Intronic
1146012345 17:29206111-29206133 CACTTGAATCCAGGAGACGGAGG - Intergenic
1146088197 17:29849944-29849966 CGCATGAACCCAGGGGGCGGAGG + Intronic
1146143125 17:30387199-30387221 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1146240373 17:31217393-31217415 CACTTCAACCCAGGAGGCGGAGG - Intronic
1146827511 17:36036024-36036046 CACTTGAACCCAGGAGACGGAGG - Intergenic
1146859005 17:36280151-36280173 CGCTTCAACCCAGGAGACGGAGG - Intronic
1146900949 17:36587801-36587823 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1146992507 17:37287657-37287679 CACTTGAACCCAGGGGGCGGAGG + Intronic
1147089327 17:38084237-38084259 CGCTTCAACCCAGGAGACGGAGG - Intergenic
1147107884 17:38236281-38236303 CGCTTCAACCCAGGAGACGGAGG + Intergenic
1147343536 17:39770887-39770909 CACTTGAACCCAGGAGACGGAGG - Intronic
1147578729 17:41617024-41617046 GACATCCTGCCAGGGGAAGGAGG - Intergenic
1147665756 17:42146663-42146685 CACTTGAACCCAGGAGACGGAGG + Intronic
1148421509 17:47551552-47551574 CGCTTCAACCCAGGAGACGGAGG - Intronic
1148535151 17:48432343-48432365 CACATGAACCCGGGGGGCGGAGG + Intergenic
1148891433 17:50810497-50810519 CACCTGAACCCAGGAGACGGAGG - Intergenic
1149534529 17:57422374-57422396 CACTTGAACCCAGGAGACGGAGG + Intronic
1149552586 17:57551355-57551377 CACACCAAGCCAGGAGTCTGTGG - Intronic
1149802691 17:59585314-59585336 CACTTGAACCCAGGAGACGGAGG + Intronic
1149843800 17:59990178-59990200 CACTTGAACCCAGGAGACGGAGG - Intergenic
1149902062 17:60489525-60489547 CACTTCAACCCAGGAGGCGGAGG + Intronic
1149949168 17:60966734-60966756 CACTTGAACCCAGGAGACGGAGG - Intronic
1149998731 17:61418456-61418478 CACTTTAAGCCAGGAGTCGGAGG + Intergenic
1150056576 17:62022082-62022104 CCCCTCAACCCAGGAGACGGAGG + Intronic
1150215125 17:63463478-63463500 CACTTGAACCCAGGAGACGGAGG - Intergenic
1150404016 17:64884447-64884469 CACTTGAAACCAGGAGACGGAGG - Intronic
1150567258 17:66352645-66352667 CACTTGAACCCAGGAGACGGAGG - Intronic
1150621824 17:66813420-66813442 CACAATAAGCCAGGGGCAGGGGG - Intergenic
1150686507 17:67325477-67325499 CACTTGAACCCAGGAGACGGAGG - Intergenic
1150739403 17:67767344-67767366 CACTTGAACCCAGGGGACAGAGG - Intergenic
1150770792 17:68039202-68039224 CACTTGAACCCAGGAGACGGAGG - Intronic
1151095469 17:71492671-71492693 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1151177457 17:72300532-72300554 CACTTGAACCCAGGAGACGGAGG + Intergenic
1152045593 17:77932988-77933010 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1152171479 17:78752514-78752536 CACTTGAACCCAGGAGACGGAGG - Intronic
1152182775 17:78834714-78834736 CAAATCAAGGCCGGGCACGGTGG - Intronic
1152488573 17:80613069-80613091 CACATCACACCAGGGCAGGGGGG - Intronic
1152811917 17:82386333-82386355 CACTACAGGCCAGGGGAAGGCGG - Intergenic
1152837224 17:82541354-82541376 CACTTGAACCCAGGAGACGGAGG - Intronic
1153567485 18:6433184-6433206 CACTTGAACCCAGGAGACGGAGG - Intergenic
1153782754 18:8508815-8508837 CACTTGAACCCAGGAGACGGAGG + Intergenic
1154156984 18:11951529-11951551 CACAACAAGGCTGGGCACGGTGG - Intergenic
1154250824 18:12743250-12743272 CACTTAAACACAGGGGACGGAGG - Intergenic
1154294839 18:13138745-13138767 CACACCAGGGCAGGTGACGGCGG - Intergenic
1154995652 18:21637899-21637921 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1155059281 18:22214127-22214149 CACATGAACCCAGGAGGCGGAGG + Intergenic
1155289606 18:24327491-24327513 CACTTGAACCCAGGAGACGGAGG - Intronic
1155531957 18:26776313-26776335 CACTTGAACCCAGGAGACGGAGG + Intergenic
1155879326 18:31124019-31124041 CACTTGAACCCAGGAGACGGAGG + Intergenic
1156120044 18:33832118-33832140 CACTTGAAACCAGGGGGCGGAGG + Intergenic
1157753335 18:50196665-50196687 CACAAAAAGCCAGGGGCCAGTGG - Intergenic
1158085606 18:53648130-53648152 CACTTGAACCCAGGAGACGGAGG - Intergenic
1158579408 18:58668683-58668705 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1158629895 18:59102681-59102703 CACCTCAACCCAGGAGGCGGAGG - Intergenic
1159054536 18:63450707-63450729 AACATGAAGCCAGGGAAGGGAGG + Intergenic
1159065998 18:63568295-63568317 CACTTGAACCCAGGGGATGGAGG + Intergenic
1159274604 18:66200602-66200624 CGCTTGAACCCAGGGGACGGAGG - Intergenic
1159444915 18:68529892-68529914 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1159639390 18:70845672-70845694 CACTTGAACCCAGGAGACGGAGG + Intergenic
1160139962 18:76312529-76312551 CACTTGAACCCAGGAGACGGAGG + Intergenic
1160425740 18:78778031-78778053 CAGAACAGGTCAGGGGACGGCGG + Intergenic
1160470653 18:79129825-79129847 CACTTGAAGCCGGGGGACGGAGG - Intronic
1160803641 19:981698-981720 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1160813658 19:1025673-1025695 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1160881162 19:1321263-1321285 GAAATCAAGGCAGGGCACGGTGG - Intergenic
1161057163 19:2196414-2196436 CACTTGAACCCAGGGGGCGGAGG - Intronic
1161168281 19:2800267-2800289 CACTTGAACCCGGGGGACGGAGG - Intronic
1161404875 19:4085829-4085851 CACTTAAACCCAGGAGACGGAGG - Intergenic
1161485990 19:4536097-4536119 CACTTGAACCCAGGGGGCGGAGG - Intronic
1161501182 19:4616866-4616888 CACTTGAACCCAGGAGACGGAGG - Intergenic
1161510473 19:4668009-4668031 CACTTGAACCCAGGAGACGGAGG - Intronic
1161515035 19:4691759-4691781 CACTTGAACCCAGGAGACGGAGG - Intronic
1161542137 19:4858459-4858481 CACTTGAACCCAGGAGACGGAGG - Intronic
1161549960 19:4907191-4907213 CACTTGAACCCAGGAGACGGAGG - Intronic
1161689850 19:5725436-5725458 CCCATCAAGGCTGGGCACGGTGG - Intronic
1161974636 19:7601400-7601422 CACTTGAACCCAGGAGACGGAGG - Intronic
1162082894 19:8229489-8229511 CACTTGAACCCAGGAGACGGAGG - Intronic
1162285019 19:9731820-9731842 CACTTCAACCCAGGAGACGGAGG - Intergenic
1162306821 19:9879858-9879880 CACTTGAACCCAGGAGACGGAGG - Intronic
1162482775 19:10938583-10938605 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1162483879 19:10946534-10946556 CACTTGAACCCAGGAGACGGAGG + Intergenic
1162557851 19:11398752-11398774 CACTTGAACCCAGGAGACGGAGG - Intronic
1162892392 19:13743290-13743312 AACATCTAGGCAGGGCACGGTGG + Intronic
1163214577 19:15866401-15866423 CACTTGAACCCAGGAGACGGAGG + Intergenic
1163361548 19:16849870-16849892 CACTTGAACCCAGGAGACGGAGG + Intronic
1163536072 19:17877391-17877413 CACTTCAACCCAGGAGGCGGAGG - Intronic
1163724077 19:18912671-18912693 CACTTGAACCCAGGAGACGGAGG + Intronic
1163762788 19:19146342-19146364 TGCAACAAGCCAGGGGGCGGTGG + Exonic
1163873251 19:19843247-19843269 CACATGAACCCAGGAGGCGGAGG + Intergenic
1163948965 19:20566581-20566603 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1164271325 19:23674557-23674579 CACTTGAACCCAGGAGACGGAGG + Intronic
1164988931 19:32670588-32670610 CACTTCAACCCAGGAGGCGGAGG + Intronic
1165498260 19:36167203-36167225 CACTTGAACCCAGGAGACGGAGG + Intergenic
1165526922 19:36363904-36363926 CACTTGAACCCAGGAGACGGAGG + Intronic
1165645051 19:37428756-37428778 CACTTGAATCCAGGAGACGGAGG - Intronic
1165746426 19:38232541-38232563 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1165876313 19:39009891-39009913 CACTTGAACCCAGGGGACGCAGG - Intronic
1165880297 19:39037927-39037949 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1165898900 19:39159467-39159489 CACTTGAACCCAGGGGGCGGAGG - Intronic
1166095998 19:40539558-40539580 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1166119928 19:40680213-40680235 CACATGAACCCTGGAGACGGAGG - Intronic
1166249835 19:41562160-41562182 CACTTGAACCCAGGAGACGGAGG + Intronic
1166451062 19:42901102-42901124 CACTTGAACCCAGGGGGCGGAGG + Intronic
1166681324 19:44768959-44768981 CACACAGAGTCAGGGGACGGTGG + Intergenic
1166687372 19:44803490-44803512 CACTTCAACCCAGGAGATGGAGG + Intergenic
1166896308 19:46023816-46023838 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1167345061 19:48940269-48940291 CACTTGAACCCAGGGGGCGGAGG + Intronic
1167478003 19:49712053-49712075 CCCATCAAGGCCGGGCACGGTGG + Intronic
1167888006 19:52517844-52517866 CACTTGAACCCAGGAGACGGAGG - Intergenic
1167950706 19:53024999-53025021 CACTTGAACCCAGGAGACGGAGG + Intergenic
1168357026 19:55707095-55707117 CACTTGAACCCAGGAGACGGAGG + Intronic
1168469132 19:56626681-56626703 CACTTGAACCCAGGAGACGGAGG + Intergenic
1168554596 19:57327426-57327448 CACTTGAACCCAGGAGACGGAGG - Intronic
1168619580 19:57867448-57867470 CACTTGAACCCAGGAGACGGAGG - Intronic
925184535 2:1837993-1838015 CACTTGAACCCAGGGGGCGGAGG - Intronic
925774166 2:7316994-7317016 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
925980700 2:9174689-9174711 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
926024272 2:9526710-9526732 CACTTCAACCCAGGGTGCGGAGG + Intronic
926200668 2:10794360-10794382 CACCTGAACCCAGGAGACGGAGG + Intronic
926330625 2:11822364-11822386 CACTTGAACCCAGGAGACGGAGG + Intronic
926583005 2:14652177-14652199 CACTTGAATCCAGGAGACGGAGG + Intergenic
926735688 2:16071763-16071785 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
927157346 2:20228536-20228558 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
928157610 2:28891012-28891034 CACTTGAACCCAGGAGACGGCGG + Intergenic
928212386 2:29333197-29333219 CACTTCAACCCAGGAGGCGGAGG - Intronic
928234197 2:29525704-29525726 CACTTGAACCCAGGAGACGGAGG + Intronic
928520152 2:32080876-32080898 CACTTGAAGCCAGGAGGCGGAGG - Intronic
928664215 2:33534610-33534632 CACATGAACCCAGGAGGCGGAGG - Intronic
929201209 2:39238833-39238855 CACTTGAACCCAGGAGACGGAGG - Intergenic
929535578 2:42781788-42781810 CACTTGAACCCAGGGGGCGGAGG + Intronic
929543018 2:42836771-42836793 CACATGAACCCAGGAGGCGGAGG + Intergenic
929574562 2:43043608-43043630 GACACCAAGCCAGGGTACTGTGG + Intergenic
929600317 2:43200433-43200455 CACCTGAACCCAGGAGACGGAGG - Intergenic
929962985 2:46510385-46510407 CACTTGAACCCAGGAGACGGAGG + Intronic
929993284 2:46807545-46807567 CACTTGAATCCAGGAGACGGAGG + Intergenic
930571834 2:53095598-53095620 CACATCAACCCTGGTGACAGAGG + Intergenic
931277024 2:60753043-60753065 CGCTTGAACCCAGGGGACGGAGG + Intergenic
931414554 2:62068706-62068728 CACTTGAACCCAGGAGACGGAGG - Intronic
931518990 2:63074567-63074589 CACTTGAACCCAGGGGGCGGAGG - Intergenic
931653720 2:64491104-64491126 CACTTGAACCCAGGAGACGGAGG + Intergenic
931686093 2:64795377-64795399 CAGATGAAGCCAGGAGATGGTGG + Intergenic
931766443 2:65460972-65460994 CACTTGAACCCAGGGGGCGGAGG - Intergenic
932189981 2:69732672-69732694 CACATGAACCCAGGAGGCGGAGG + Intronic
932254897 2:70276014-70276036 CACATGAACCCAGGGGGCAGAGG + Intronic
932697094 2:73966055-73966077 CACTTGAACCCAGGGGGCGGAGG - Intergenic
932727598 2:74192861-74192883 CACTTGAACCCAGGGGGCGGAGG + Intergenic
933309250 2:80639495-80639517 CACATCAAGGCTGGGCATGGTGG - Intronic
933826004 2:86161595-86161617 CACCTCAACCCAGGAGGCGGAGG - Intronic
934028846 2:88023535-88023557 CACTTGAACCCAGGAGACGGAGG - Intergenic
934510119 2:94931158-94931180 CACTTGAACCCAGGAGACGGAGG + Intergenic
934527408 2:95060149-95060171 GCCACCAAGCCAGGAGACGGTGG + Intergenic
934553815 2:95277202-95277224 CACATTAAGCCAGGGGAGGGGGG - Intronic
934678878 2:96268266-96268288 CACTTGAACCCAGGAGACGGGGG + Intronic
935782849 2:106523248-106523270 CACATAAAGCCAGGTGATCGAGG - Intergenic
936022217 2:109003492-109003514 CACGTGAACCCAGGAGACGGAGG - Intergenic
936675630 2:114710659-114710681 CCCATGAACCCAGGAGACGGAGG + Intronic
936976643 2:118227390-118227412 CACTTGAACCCAGGAGACGGAGG + Intergenic
936984570 2:118296880-118296902 CACATGATGCCAGCAGACGGTGG + Intergenic
937108519 2:119342526-119342548 CACTTGAACCCAGGAGACGGAGG + Intronic
938045618 2:128117171-128117193 CACTTGAACCCAGGAGACGGAGG - Intronic
938845345 2:135202890-135202912 CACATCAAGCCAGTGTATGGGGG - Exonic
938911130 2:135886944-135886966 CACTTGAACCCAGGAGACGGAGG - Intergenic
939394929 2:141616196-141616218 CACTTGAACCCAGGAGACGGAGG + Intronic
939508544 2:143077754-143077776 CACTTGAACCCAGGGGGCGGAGG - Intergenic
940068352 2:149654992-149655014 CACTTGAATCCAGGAGACGGAGG - Intergenic
940286789 2:152040523-152040545 CACTTGAACCCAGGGGGCGGAGG - Intronic
940304144 2:152207671-152207693 CACTTGAAGCCAGGAGATGGAGG - Intergenic
940519629 2:154727506-154727528 CACTTGAACCCAGGGGGCGGAGG + Intronic
941539186 2:166761240-166761262 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
941726237 2:168863992-168864014 CACTTGAATCCAGGAGACGGAGG - Intronic
941726245 2:168864049-168864071 CACTTGAATCCAGGAGACGGAGG - Intronic
941936594 2:170986425-170986447 CACTTGAACCCAGGGGGCGGAGG + Intergenic
942053798 2:172164151-172164173 CACTTGAACCCAGGGGGCGGAGG - Intergenic
942095322 2:172531654-172531676 CACTTGAACCCAGGAGACGGAGG - Intergenic
942287711 2:174437666-174437688 CACTTGAACCCAGGAGACGGAGG - Intronic
942436580 2:175984260-175984282 CACATGAACCCAGGAGGCGGAGG - Intronic
942938075 2:181582617-181582639 CACTTGAACCCAGGGGGCGGAGG - Intronic
943080369 2:183252629-183252651 CACTTGAACCCAGGGGACAGAGG - Intergenic
943556069 2:189405313-189405335 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
943840492 2:192574262-192574284 GACATTAAGCCTGGGGACAGTGG + Intergenic
944229419 2:197377920-197377942 CACATCAACCCAGGAGGCAGAGG - Intergenic
944705377 2:202283522-202283544 CACTTCAACCCAGGAGGCGGAGG - Intronic
944987549 2:205194865-205194887 CACTTGAACCCAGGGGGCGGAGG - Intronic
945081514 2:206090644-206090666 CACTTAAACCCAGGGGGCGGAGG + Intergenic
945084711 2:206119491-206119513 CACTTAAACCCAGGAGACGGAGG - Intronic
945190866 2:207185943-207185965 CACTTGAACCCAGGGGGCGGAGG + Intergenic
945223438 2:207507590-207507612 CGCTTGAACCCAGGGGACGGAGG + Intergenic
945446146 2:209940731-209940753 CACATGAACCCAGGAGATGGAGG + Intronic
945447140 2:209951582-209951604 CACATTAGGGCAGGGCACGGCGG - Intronic
945646132 2:212497092-212497114 CACTTCAACCCAGGAGGCGGAGG + Intronic
945774298 2:214085286-214085308 CACTTGAACCCAGGAGACGGAGG + Intronic
945945085 2:215987817-215987839 CACTTGAAACCAGGAGACGGAGG + Intronic
946151946 2:217780314-217780336 CACTTCAACCCAGGAGGCGGAGG + Intergenic
946916765 2:224530821-224530843 CACTTCAACCCAGGAGGCGGAGG + Intronic
947787952 2:232841600-232841622 CAAATGAAGGCAGGGCACGGTGG - Intronic
947814225 2:233025214-233025236 CACTTGAACCCAGGAGACGGAGG - Intergenic
948074202 2:235153114-235153136 CACTTGAACCCAGGAGACGGAGG - Intergenic
948367514 2:237466998-237467020 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1169041384 20:2498270-2498292 CACTTGAACCCAGGAGACGGAGG + Intronic
1169456773 20:5759036-5759058 CACTTGAAGCCAGGAGATGGAGG - Intronic
1169797926 20:9485130-9485152 CACTTGAACCCAGGAGACGGAGG - Intergenic
1170845163 20:19956172-19956194 CACTTGAACCCAGGAGACGGAGG + Intronic
1171985276 20:31656078-31656100 CACTTGAACCCAGGGGACAGAGG + Intergenic
1172048394 20:32098129-32098151 CACTTGAACCCAGGGGATGGAGG - Intronic
1172155147 20:32819216-32819238 CACTTGAACCCAGGAGACGGAGG - Intergenic
1172545731 20:35759807-35759829 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1172665440 20:36596169-36596191 CACTTGAACCCAGGAGACGGAGG - Intronic
1172668341 20:36616412-36616434 CACTTCAACCCAGGAGGCGGAGG - Intronic
1172700893 20:36852971-36852993 CACTTGAACCCAGGAGACGGAGG + Intronic
1172979097 20:38927580-38927602 CACTTGAACCCGGGGGACGGAGG - Intronic
1173247649 20:41347588-41347610 CACATGAAGCTTGGGGACAGCGG + Exonic
1173486882 20:43447613-43447635 CACTTGAACCCAGGAGACGGAGG + Intergenic
1173947244 20:46961240-46961262 CACTTAAACCCAGGAGACGGAGG + Intronic
1173986007 20:47261985-47262007 CACTTCAACCCAGGAGGCGGAGG + Intronic
1174040959 20:47698945-47698967 CACATGAACCCAGGAGACAGAGG + Intronic
1174591710 20:51650448-51650470 CACTTGAACCCAGGAGACGGAGG + Intronic
1174644305 20:52072402-52072424 CACTTGAAGCCAGGGGTTGGAGG - Intronic
1175113432 20:56664934-56664956 CACACCAGGACAGGGGATGGGGG + Intergenic
1175618225 20:60421522-60421544 CAGTTGAACCCAGGGGACGGAGG - Intergenic
1176107326 20:63395604-63395626 CAGCTCCAGGCAGGGGACGGGGG + Intergenic
1176175481 20:63721266-63721288 CGCTTCAACCCAGGGGGCGGAGG + Intronic
1176246364 20:64099126-64099148 CACATGAAGCACGGGGAGGGAGG - Exonic
1176276431 20:64272734-64272756 CACTTGAACCCAGGAGACGGAGG + Intronic
1176302117 21:5103397-5103419 CACATAAACCCAGGAGGCGGAGG + Intergenic
1176711459 21:10153461-10153483 AACAACAAGCCAGGGGGAGGAGG + Intergenic
1177486145 21:21758772-21758794 CACCTCCAGCCAAGGGACAGGGG + Intergenic
1178160394 21:29905527-29905549 CACTTGAACCCAGGAGACGGAGG - Intronic
1178925559 21:36771913-36771935 CACTTGAACCCAGGGGGCGGAGG + Intronic
1178999247 21:37440217-37440239 CACTTGAACCCAGGGGGCGGAGG - Intronic
1180058153 21:45369936-45369958 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1180820918 22:18827057-18827079 CAAATCAAGTCAGGAGAAGGTGG + Intergenic
1180832000 22:18911240-18911262 CACAGCAGGCCTGGGGAGGGTGG - Intronic
1181192059 22:21148988-21149010 CAAATCAAGTCAGGAGAAGGTGG - Intergenic
1181207138 22:21261522-21261544 CAAATCAAGTCAGGAGAAGGTGG + Intergenic
1181287621 22:21765654-21765676 CACATGAATCCAGGGGAAGCTGG - Intronic
1181518111 22:23428289-23428311 CACTTGAACCCAGGAGACGGAGG - Intergenic
1181699557 22:24612608-24612630 CACCTGAATCCAGGAGACGGAGG - Intronic
1181820812 22:25474197-25474219 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1182334885 22:29577501-29577523 CACTTGAACCCAGGGGGCGGAGG - Intronic
1182482510 22:30618433-30618455 CACTTGAACCCAGGAGACGGAGG - Intronic
1182483265 22:30623434-30623456 CACATGAACCCAGGAGGCGGAGG - Intronic
1182613976 22:31573519-31573541 CACCTGAACCCAGGAGACGGAGG - Intronic
1183202210 22:36393144-36393166 CACTTCAACCCAGGAGGCGGGGG + Intergenic
1183603044 22:38851070-38851092 CACATGAAGCCAGGGTGGGGTGG + Intergenic
1184166787 22:42734084-42734106 CACTTCAACCCAGGAGACGGAGG + Intergenic
1184261359 22:43318811-43318833 CACTTGAACCCAGGAGACGGAGG - Intronic
1184719239 22:46300179-46300201 CACTTGAACCCAGGAGACGGAGG - Intronic
1203219782 22_KI270731v1_random:33894-33916 CAAATCAAGTCAGGAGAAGGTGG - Intergenic
1203271045 22_KI270734v1_random:52933-52955 CAAATCAAGTCAGGAGAAGGTGG + Intergenic
1203282078 22_KI270734v1_random:136511-136533 CACAGCAGGCCTGGGGAGGGTGG - Intergenic
949174270 3:1039472-1039494 CACATGAAGCCAGTGGGCCGTGG + Intergenic
949521074 3:4854487-4854509 CGCTTGAACCCAGGGGACGGAGG + Intronic
949832979 3:8236195-8236217 CACTTGAACCCAGGGGGCGGAGG + Intergenic
950001875 3:9663010-9663032 CACATCAGGGCAGAGGATGGAGG + Intronic
950026580 3:9824492-9824514 CACTTCAAGCCAGGAGGCGGAGG - Intronic
950235600 3:11317674-11317696 CACTTGAAGCCAGGAGGCGGAGG - Intronic
950651815 3:14411986-14412008 CAGAGCAAGCCAGAGGACAGGGG - Intronic
951547851 3:23846610-23846632 CACTTGAACCCAGGGGGCGGAGG + Intronic
951554920 3:23911368-23911390 CACTTGAACCCAGGGGGCGGAGG + Intronic
951561776 3:23974900-23974922 CACTTGAACCCAGGGGATGGAGG - Intronic
952328440 3:32341791-32341813 CACTTGAACCCAGGGGTCGGAGG + Intronic
952569995 3:34702376-34702398 CACTTGAACCCAGGAGACGGAGG - Intergenic
952968276 3:38634395-38634417 CACATCAAACCAGGGAATGGTGG + Intronic
953498813 3:43412965-43412987 CACATGAACCCAGGAGGCGGAGG + Intronic
953523034 3:43660868-43660890 CACTTGAACCCAGGAGACGGAGG + Intronic
953617682 3:44506794-44506816 CACTTGAATCCAGGAGACGGAGG - Intronic
953681370 3:45041053-45041075 CACTTGAAGCCAGGAGACAGAGG - Intergenic
953687359 3:45088400-45088422 CACTTCAACCCAGGAGGCGGAGG + Intronic
954204639 3:49049359-49049381 CACTTGAACCCAGGAGACGGAGG + Intronic
954307866 3:49739929-49739951 CACTTGAAGCCGGGAGACGGAGG + Intronic
954389712 3:50262209-50262231 CACTTGAACCCAGGAGACGGTGG + Intergenic
954407306 3:50352394-50352416 CGCATGAACCCAGGAGACGGAGG + Intronic
955073871 3:55594563-55594585 CACATGAACCCAGGGTGCGGAGG - Intronic
955288972 3:57673128-57673150 CACTTGAACCCAGGAGACGGAGG + Intronic
955317702 3:57952640-57952662 CCTATCAAGCCAGGGGTCTGTGG - Intergenic
955486252 3:59437749-59437771 CACTTGAACCCAGGAGACGGAGG + Intergenic
955541387 3:59980270-59980292 CACTTCAGGCCAGAGGAAGGTGG + Intronic
955908033 3:63828381-63828403 CACTTAAACCCAGGAGACGGAGG - Intronic
956824924 3:72988854-72988876 CACTTGAACCCAGGAGACGGAGG - Intronic
956839046 3:73120296-73120318 CGCTTGAACCCAGGGGACGGAGG - Intergenic
956953413 3:74309186-74309208 CACATGAACCCAGGAGATGGAGG - Intronic
957175198 3:76799128-76799150 CACTTGAACCCAGGAGACGGAGG + Intronic
958425314 3:93972763-93972785 CACTTGAAGCCGGGGGGCGGAGG + Intronic
959711399 3:109389653-109389675 CACTTCAACCCAGGAGGCGGAGG - Intergenic
960226300 3:115173374-115173396 CACCTTAAGCCAGGTGACTGAGG + Intergenic
960677650 3:120212269-120212291 CACTTGAACCCAGGAGACGGAGG - Intronic
960910654 3:122645792-122645814 CACTTGAACCCAGGAGACGGAGG + Intergenic
960916695 3:122702298-122702320 CACTTGAACCCAGGGGGCGGAGG - Intronic
961725319 3:128924526-128924548 CACATGAACCCAGGGGATGGAGG - Intronic
961770282 3:129244549-129244571 CACTTCAACCCAGGAGGCGGAGG - Intergenic
962518401 3:136175258-136175280 CACTTCAACCCAGGAGGCGGAGG + Intronic
962558676 3:136582713-136582735 CACTTGAACCCAGGAGACGGAGG + Intronic
962798170 3:138866702-138866724 CACATCAGCCCAGGTGACAGTGG + Intergenic
963848177 3:150181210-150181232 CACTTAAACCCAGGGGGCGGAGG - Intergenic
963889480 3:150617938-150617960 CACTTCAACCCAGGAGGCGGGGG - Intronic
963995141 3:151700305-151700327 CACTTGAACCCAGGAGACGGAGG - Intergenic
964114830 3:153125036-153125058 CACTTGAAGCCAGGAGACAGAGG - Intergenic
964592247 3:158377741-158377763 CACTTGAACCCAGGGGGCGGAGG - Intronic
964611240 3:158617921-158617943 CACTTCAACCCGGGGGATGGAGG + Intergenic
964963000 3:162451190-162451212 CACTTGAACCCAGGAGACGGAGG + Intergenic
965197563 3:165621241-165621263 CACATAAACCCAGGAGACAGAGG + Intergenic
965758514 3:172050465-172050487 CACATGAACCCAGGAGACGGAGG - Intronic
966425937 3:179779444-179779466 CACTTGAAGCCAGGGGGTGGAGG + Intronic
966625692 3:182013903-182013925 CACTTGAACCCAGGAGACGGAGG - Intergenic
966973477 3:185065955-185065977 CACATGAACCCAGGAGACAGAGG + Intergenic
966991177 3:185232530-185232552 CACTTGAACCCAGGAGACGGAGG - Intronic
967281401 3:187827483-187827505 CACTTGAACCCAGGAGACGGGGG - Intergenic
967668033 3:192197860-192197882 CACTTGAACCCAGGGGACGGAGG + Intronic
967832440 3:193931866-193931888 CACTTGAACCCAGGAGACGGAGG + Intergenic
968079905 3:195838624-195838646 CACTTGAATCCAGGAGACGGAGG + Intergenic
968169555 3:196498909-196498931 CACTTGAACCCAGGAGACGGAGG + Intronic
968225963 3:196972307-196972329 CACTTGAACCCAGGAGACGGAGG - Intergenic
968297590 3:197589226-197589248 CACATCAACCCAGGAGGCGGAGG + Intergenic
969157158 4:5221142-5221164 CCCATCAATCTAGGGGAGGGAGG - Intronic
969233193 4:5846210-5846232 CACTTGAACCCAGGAGACGGGGG + Intronic
969455822 4:7299076-7299098 CACATAAAGCCGGGGGTTGGTGG + Intronic
969468575 4:7372388-7372410 CCCTTAAACCCAGGGGACGGAGG - Intronic
969792352 4:9500634-9500656 CGCTTGAACCCAGGGGACGGAGG - Intergenic
970121226 4:12754822-12754844 CACTTGAACCCAGGGGGCGGAGG - Intergenic
970619522 4:17803106-17803128 CACTTGAACCCAGGAGACGGAGG - Exonic
971314858 4:25559242-25559264 CACTTGAACCCAGGGGGCGGAGG + Intergenic
971416713 4:26438659-26438681 CACTTGAACCCAGGGGACAGAGG - Intergenic
971619077 4:28830343-28830365 CACTTCAACCCAGGAGGCGGAGG + Intergenic
972434920 4:39024117-39024139 CACTTGAACCCAGGGGGCGGAGG - Intronic
972444116 4:39127235-39127257 CACTTCAGCCCAGGAGACGGAGG + Intergenic
972504401 4:39706988-39707010 CACTTGAAGCCAGGAGGCGGAGG - Intronic
974027363 4:56745582-56745604 CACTTCAAGGAAGGGGAGGGTGG - Intergenic
974937834 4:68429590-68429612 CACTTGAACCCAGGAGACGGAGG - Intergenic
975283160 4:72586487-72586509 CACTTCAACCCAGGAGGCGGAGG + Intergenic
975312348 4:72916524-72916546 CACTTGAACCCAGGGGATGGAGG + Intergenic
975645613 4:76543007-76543029 CCCATCCAGCCAGGGAATGGTGG + Intronic
976110655 4:81669633-81669655 CACTTGAACCCAGGAGACGGAGG + Intronic
976527970 4:86115543-86115565 CACTTGAACCCAGGGGTCGGAGG - Intronic
976598454 4:86915701-86915723 CACTTGAACCCAGGAGACGGAGG + Intronic
976636381 4:87290760-87290782 CACTTGAACCCAGGAGACGGAGG - Intergenic
977153842 4:93548091-93548113 CACTTCAACCCGGGAGACGGAGG + Intronic
977631625 4:99249200-99249222 CACTTGAACCCAGGGGGCGGAGG - Intergenic
977896222 4:102368566-102368588 CACTTGAACCCAGGGAACGGAGG - Intronic
978904238 4:113987039-113987061 CACATGAACCCAGGAGATGGAGG - Intergenic
979265251 4:118694883-118694905 CACTTGAACCCAGGGGGCGGAGG - Intronic
980132949 4:128833608-128833630 CACTTGAACCCAGGAGACGGAGG + Intronic
980384498 4:132069712-132069734 CACTTGAATCCAGGAGACGGAGG - Intergenic
980690645 4:136292394-136292416 CACTTGAAACCAGGAGACGGGGG - Intergenic
981067932 4:140505175-140505197 CACATCAGGGCTGGGCACGGTGG - Intergenic
981349621 4:143714176-143714198 CAGGTCAAGCCAGGGGACAGAGG - Intergenic
981595334 4:146414637-146414659 CACTTGAACCCAGGAGACGGAGG + Intronic
982357987 4:154490541-154490563 CAGATCGAGGCATGGGACGGCGG - Intronic
983031969 4:162814189-162814211 CACTTCAACCCAGGAGGCGGAGG - Intergenic
983639167 4:169928620-169928642 CACTTGAACCCAGGAGACGGAGG - Intergenic
984836834 4:184030070-184030092 CACTTTAACCCAGGAGACGGAGG + Intergenic
984971857 4:185198703-185198725 CACTTGAAGCCAGGAGATGGAGG + Intronic
986811146 5:11361102-11361124 CACTTGAAGCCAGGAGATGGAGG - Intronic
986976365 5:13398825-13398847 CACATGAACCCAGGAGGCGGAGG + Intergenic
987188961 5:15453492-15453514 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
987272785 5:16329453-16329475 CACTTGAACCCAGGAGACGGAGG - Intergenic
987370557 5:17189068-17189090 CACTTGAACCCAGGAGACGGAGG - Intronic
987460737 5:18206740-18206762 CACTTGAACCCAGGAGACGGAGG - Intergenic
988509212 5:31851938-31851960 CACTTCAACCCAGGAGGCGGAGG - Intronic
989389552 5:40886025-40886047 CGCTTGAACCCAGGGGACGGAGG - Intergenic
990102744 5:52213527-52213549 CACTTCAACCCAGGAGGCGGAGG - Intergenic
991324947 5:65420463-65420485 CACTTGAACCCAGGGGGCGGAGG - Intronic
991365113 5:65860054-65860076 CACTTGAACCCAGGAGACGGAGG + Intronic
991673721 5:69072661-69072683 CACTTGAACCCAGGAGACGGAGG + Intergenic
991726212 5:69538387-69538409 CACTTGAACCCAGGAGACGGAGG - Intronic
991868745 5:71089487-71089509 CACTTGAACCCAGGAGACGGAGG + Intergenic
991911209 5:71563229-71563251 CACTTGAACCCAGGGGATGGAGG - Intronic
992288703 5:75262707-75262729 CACATGAATCCAGGAGGCGGAGG - Intergenic
992633148 5:78700971-78700993 CACTTGAACCCAGGAGACGGAGG - Intronic
992711492 5:79462113-79462135 CACTTGAACCCAGGAGACGGAGG + Intronic
993147117 5:84109420-84109442 CACTTGAAGCCAGGAGGCGGAGG + Intronic
993365875 5:87033595-87033617 CACTTGAACCCAGGAGACGGAGG + Intergenic
993378183 5:87174647-87174669 CACATGAACCCAGGAGACGGAGG + Intergenic
993502783 5:88680857-88680879 CTCATAAAACCAAGGGACGGTGG - Intergenic
993722794 5:91338255-91338277 CGCATGAACCCAGGAGACGGAGG - Intergenic
995873644 5:116767698-116767720 CACTTCAACCCAGGAGGCGGAGG + Intergenic
995894562 5:116997534-116997556 CGCTTGAACCCAGGGGACGGAGG + Intergenic
997382481 5:133447621-133447643 CACTTGAACCCAGGAGACGGAGG - Intronic
997597423 5:135116377-135116399 CAAATCATGCCAGGGGAATGGGG - Intronic
997927556 5:138044466-138044488 CACTTGAACCCAGGGGGCGGAGG + Intronic
997960660 5:138318227-138318249 CACTTAAACCCAGGAGACGGAGG + Intronic
998129017 5:139641880-139641902 CACCTCAATCCAGGGGAAGGAGG - Intergenic
998271048 5:140707008-140707030 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
998303376 5:141048741-141048763 CACTTCAACCCAGGAGATGGAGG - Intergenic
998834744 5:146192576-146192598 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
998858803 5:146422790-146422812 CACTTGAACCCAGGGGGCGGAGG + Intergenic
998860376 5:146437725-146437747 CACTTCAACCCAGGAGATGGAGG - Intergenic
999269951 5:150291048-150291070 CACTTGAACCCAGGAGACGGAGG - Intergenic
999540730 5:152569806-152569828 CACTTGAACCCAGGGGTCGGAGG - Intergenic
999966572 5:156816603-156816625 CACCTTAAGCCAAGGGATGGAGG + Intergenic
999995599 5:157089450-157089472 CACATGAACCCGGGAGACGGAGG + Intronic
1000063137 5:157673726-157673748 CACATGAACCCAGGAGGCGGAGG - Intronic
1000324570 5:160162504-160162526 CGCTTCAACCCAGGAGACGGAGG - Intergenic
1000646367 5:163765048-163765070 CAAATAATGCCAGGGGATGGAGG + Intergenic
1001042126 5:168343736-168343758 CACTTCAACCCAGGAGGCGGAGG + Intronic
1001655246 5:173344288-173344310 CACTTGAACCCAGGAGACGGAGG - Intergenic
1001926348 5:175639980-175640002 AACAGGAAGCCAGGGGACGAGGG - Intergenic
1002126564 5:177049918-177049940 CACTTCAACCCAGGAGGCGGAGG - Intronic
1002479405 5:179489854-179489876 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1002509735 5:179706525-179706547 CACTTGAACCCAGGAGACGGAGG - Intronic
1003685482 6:8298125-8298147 CACTTCAACCCAGGAGGCGGGGG - Intergenic
1003993370 6:11511514-11511536 CGCTTCAACCCAGGGGCCGGAGG - Intergenic
1004889662 6:20088530-20088552 CACTTGAACCCAGGAGACGGAGG - Intergenic
1004903510 6:20214502-20214524 CGCCTGAACCCAGGGGACGGAGG + Intergenic
1004909925 6:20273118-20273140 CACATGAAGTCAGGAGGCGGAGG - Intergenic
1004936412 6:20512519-20512541 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1005206870 6:23414867-23414889 CACTTGAACCCAGGAGACGGAGG + Intergenic
1005425194 6:25695611-25695633 CACATGAACCCAGGAGGCGGAGG - Intronic
1005666885 6:28066739-28066761 CACTTCAACCCAGGAGATGGAGG - Intergenic
1006400830 6:33816320-33816342 CACTTGAACCCAGGGGCCGGAGG - Intergenic
1006464983 6:34187902-34187924 CACAACAAGCCAGGCAAAGGAGG + Intergenic
1007582230 6:42966421-42966443 CACATCATGCCAGGACACTGAGG + Exonic
1007946652 6:45833216-45833238 CACTTGAACCCAGGAGACGGAGG - Intergenic
1008787525 6:55187327-55187349 CACTTCAACCCGGGAGACGGAGG + Intronic
1009330982 6:62419471-62419493 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1009423562 6:63489788-63489810 CACTTGAACCCAGGAGACGGAGG - Intergenic
1010416475 6:75617355-75617377 CACTTGAACCCAGGAGACGGAGG - Intronic
1010428527 6:75752074-75752096 CACTTGAACCCAGGAGACGGAGG - Intronic
1010469131 6:76205092-76205114 GACATCAAGGCAGGAGACAGGGG - Intergenic
1011162098 6:84402896-84402918 CACTTGAACCCAGGAGACGGAGG + Intergenic
1011589807 6:88961518-88961540 CACTTGAACCCAGGAGACGGAGG - Intronic
1012282400 6:97344364-97344386 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1012501288 6:99890618-99890640 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1012876708 6:104737206-104737228 CACTTGAACCCAGGGGGCGGAGG + Intronic
1013140176 6:107326184-107326206 CACTTCAACCCGGGAGACGGAGG - Intronic
1013237674 6:108212420-108212442 CACTTGAACCCAGGAGACGGAGG - Intronic
1013247632 6:108302028-108302050 CACTTGAACCCAGGAGACGGAGG - Intronic
1013351382 6:109309027-109309049 CACCTGAACCCAGGAGACGGAGG + Intergenic
1013496837 6:110706134-110706156 CACATCAACCCAGGAGGCAGAGG - Intronic
1013517481 6:110901591-110901613 CACTTGAACCCAGGAGACGGAGG - Intergenic
1014140706 6:117938854-117938876 CACAGCAAGCCAGGGGCCTGAGG - Intronic
1015058569 6:128934583-128934605 CACTTGAACCCAGGAGACGGAGG - Intronic
1015143881 6:129964298-129964320 CACTTGAACCCAGGAGACGGAGG + Intergenic
1015507653 6:134006086-134006108 CATTTCAACCCAGGGGCCGGAGG + Intronic
1015525149 6:134168595-134168617 CACATGAACCCAGGAGGCGGAGG + Intergenic
1016986537 6:149899732-149899754 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1017126824 6:151072703-151072725 CACTTGAACCCAGGGGACAGAGG + Intronic
1017187725 6:151618915-151618937 CACTTGAACCCAGGAGACGGAGG + Exonic
1017381450 6:153836006-153836028 CACTTGAACCCAGGAGACGGAGG + Intergenic
1017473937 6:154768977-154768999 CACTTGAACCCAGGAGACGGAGG + Intronic
1017494147 6:154968390-154968412 CACTTGAACCCAGGAGACGGAGG + Intronic
1017683943 6:156893124-156893146 CACATGAACCCAGGAGGCGGAGG - Intronic
1017872175 6:158495754-158495776 CACTTGAACCCAGGGGGCGGAGG + Intronic
1017906344 6:158759614-158759636 CACTTGAACCCAGGGGACAGAGG - Intronic
1017928168 6:158928482-158928504 CACTTGAACCCAGGAGACGGAGG - Intergenic
1019372395 7:669678-669700 CACTTGAACCCAGGAGACGGAGG + Intronic
1019654055 7:2178811-2178833 CACCTGAACCCAGGAGACGGAGG + Intronic
1019661594 7:2227210-2227232 CACTTGAACCCAGGAGACGGAGG + Intronic
1019754523 7:2759054-2759076 CACTTGAACCCAGGGGGCGGAGG + Intronic
1019838362 7:3413605-3413627 CACTTGAACCCAGGGGGCGGTGG + Intronic
1020019665 7:4855877-4855899 CACTTGAACCCAGGAGACGGAGG - Intronic
1020247912 7:6444516-6444538 CACTTGAACCCAGGAGACGGAGG + Intronic
1020913237 7:14159754-14159776 CACTTGAACCCAGGAGACGGGGG - Intronic
1020933219 7:14426974-14426996 CACCTGAACCCAGGAGACGGAGG + Intronic
1021733190 7:23617262-23617284 CACTTGAATCCAGGAGACGGAGG + Intronic
1021990138 7:26133143-26133165 CACTTGAACCCAGGAGACGGAGG + Intergenic
1022173466 7:27851360-27851382 CACATCAAGGCTGGGCATGGTGG + Intronic
1022535549 7:31096156-31096178 CACTTCAAGGCAGGGGGCTGAGG - Intronic
1022555730 7:31294021-31294043 CACTTGAACCCAGGAGACGGAGG - Intergenic
1022982866 7:35620792-35620814 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1023095996 7:36660397-36660419 CACTTGAACCCAGGGGGCGGAGG - Intronic
1023624268 7:42100656-42100678 CACTTGAAGCCAGGGGGCGAAGG + Intronic
1023792085 7:43760850-43760872 CACTTGAACCCAGGGGGCGGAGG - Intronic
1023835114 7:44063366-44063388 CACTTCAACCCAGGAGATGGAGG - Intronic
1024364294 7:48503444-48503466 CACCTCAGGCCAGGGGAAAGAGG - Intronic
1024506129 7:50163274-50163296 CACATGAATCCAGGAGGCGGAGG + Intergenic
1024717801 7:52100586-52100608 CACTTGAACCCAGGGGACAGAGG + Intergenic
1025094340 7:56085888-56085910 CACTTGAACCCAGGAGACGGAGG + Intronic
1025634591 7:63310958-63310980 CACTTGAACCCAGGAGACGGAGG + Intergenic
1025636135 7:63321093-63321115 CACTTCAACCCGGGAGACGGAGG + Intergenic
1025646561 7:63427087-63427109 CACTTCAACCCGGGAGACGGAGG - Intergenic
1025648105 7:63437216-63437238 CACTTGAACCCAGGAGACGGAGG - Intergenic
1025831065 7:65050439-65050461 CATATCACGGCAGGGCACGGTGG + Intergenic
1025833574 7:65075506-65075528 CGCTTGAAGCCAGGGGGCGGAGG + Intergenic
1025867696 7:65401970-65401992 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1025903331 7:65765015-65765037 CCCTTGAAGCCAGGGGGCGGAGG + Intergenic
1026032529 7:66806725-66806747 CACTTGAACCCAGGAGACGGAGG - Intronic
1026078309 7:67193673-67193695 CACTTCAACCCAGGAGGCGGAGG + Intronic
1026283370 7:68941692-68941714 CACGTGAACCCAGGAGACGGAGG + Intergenic
1026328620 7:69332921-69332943 CACTTGAACCCAGGAGACGGAGG + Intergenic
1026337260 7:69405285-69405307 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1026618682 7:71931347-71931369 CACTTGAAGCCAGGAGACGGAGG - Intronic
1026701845 7:72653994-72654016 CACATGAACCCAGGAGGCGGAGG + Intronic
1026705420 7:72687348-72687370 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG + Intergenic
1027785150 7:82571278-82571300 CACTTCAACCCAGGAGATGGAGG + Intergenic
1028116280 7:87001540-87001562 AACATCAAGCCAGGGTGAGGTGG + Intronic
1028272377 7:88808296-88808318 CACTTGAACCCAGGAGACGGAGG + Intronic
1029213674 7:98929675-98929697 CACTTGAACCCAGGAGACGGAGG - Intronic
1029251760 7:99241942-99241964 CACTTGAACCCAGGGGGCGGGGG - Intergenic
1029727119 7:102414141-102414163 CACTTGAACCCAGGAGACGGTGG + Intronic
1029986871 7:104930607-104930629 CACTTGAACCCAGGAGACGGAGG + Intergenic
1030038797 7:105431588-105431610 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1030115012 7:106056228-106056250 CACTTGAACCCAGGAGACGGAGG + Intergenic
1031610223 7:123817592-123817614 CACTTGAACCCAGGAGACGGAGG - Intergenic
1032060877 7:128724092-128724114 CACATCAACCCAGGAGGCAGAGG - Intronic
1032351358 7:131166767-131166789 CACTTGAACCCAGGAGACGGAGG - Intronic
1032673042 7:134102548-134102570 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1033048755 7:137985349-137985371 CAGTTCAGGCCAGGGGTCGGAGG + Intronic
1033092360 7:138397465-138397487 CACTTGAACCCAGGGCACGGAGG + Intergenic
1033307230 7:140233842-140233864 CAAAATTAGCCAGGGGACGGTGG - Intergenic
1033402521 7:141040267-141040289 CACTTGAACCCAGGAGACGGAGG - Intergenic
1033771706 7:144559360-144559382 CACTTGAACCCAGGAGACGGAGG + Intronic
1033987102 7:147239424-147239446 CACTTGAACCCAGGAGACGGGGG + Intronic
1033987375 7:147243079-147243101 CACTTGAAACCAGGAGACGGAGG - Intronic
1034833690 7:154332153-154332175 CACTTGAACCCAGGAGACGGAGG - Intronic
1034914556 7:155026105-155026127 CACTTGAACCCAGGAGACGGAGG + Intergenic
1035751021 8:1996348-1996370 CACCTGAACCCAGGGGGCGGAGG - Intronic
1037195996 8:16190803-16190825 CACATGAACCCAGGAGGCGGAGG - Intronic
1037892813 8:22632790-22632812 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1038015797 8:23513713-23513735 CACTTGAACCCAGGAGACGGAGG - Intergenic
1038025060 8:23580934-23580956 CACTTGAACCCAGGAGACGGAGG - Intergenic
1038502281 8:28055167-28055189 CACTTGAACCCAGGAGACGGAGG + Intronic
1038522964 8:28248971-28248993 CACTTAAACCCAGGAGACGGAGG + Intergenic
1038700289 8:29843357-29843379 CACTTGAACCCAGGAGACGGAGG - Intergenic
1038931594 8:32199861-32199883 CACATGAACCCAGGAGGCGGAGG - Intronic
1039024423 8:33242248-33242270 CACTTCAACCCAGGAGACAGAGG + Intergenic
1039825660 8:41172170-41172192 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1039949547 8:42158330-42158352 CACTTCAACCCAGGAGGCGGAGG - Intronic
1039975716 8:42363038-42363060 CACTTGAACCCAGGAGACGGAGG + Intronic
1040365566 8:46711628-46711650 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1040530321 8:48261343-48261365 CACAGCAAGCCAGCAGATGGGGG + Intergenic
1040738162 8:50536702-50536724 CACCTCAAGCCTGGAGACGTCGG - Exonic
1040758991 8:50814659-50814681 CACTTGAACCCAGGAGACGGAGG + Intergenic
1041265685 8:56062040-56062062 CACTTGAAGCCAGGAGGCGGAGG + Intergenic
1041508124 8:58624123-58624145 CACTTGAACCCAGGAGACGGAGG - Intronic
1041680101 8:60580078-60580100 CACTTGAAGCCAGGAGGCGGAGG - Intronic
1042021905 8:64377897-64377919 CCCCTGAAGCCTGGGGACGGAGG + Intergenic
1042113117 8:65402623-65402645 CACTTGAACCCAGGAGACGGAGG + Intergenic
1042124755 8:65527107-65527129 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1042289483 8:67154448-67154470 CACTTAAAGCCAGGAGGCGGAGG - Intronic
1042327724 8:67546025-67546047 CCCATCCTGCCAGGGGATGGAGG - Intronic
1042586688 8:70347399-70347421 CACTTGAACCCAGGGGGCGGAGG + Intronic
1043332460 8:79134148-79134170 CACTTGAAGCCAGGAGACAGTGG + Intergenic
1043458882 8:80439326-80439348 CACATGAACCCAGGAGGCGGTGG + Intergenic
1043843631 8:85138960-85138982 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1043852223 8:85228168-85228190 CACTTGAACCCAGGAGACGGAGG + Intronic
1044013866 8:87027353-87027375 CACTTGAACCCAGGAGACGGTGG - Intronic
1044448458 8:92305808-92305830 CACATGAACCCAGGAGGCGGAGG - Intergenic
1044570164 8:93709194-93709216 CACTTCAACCCAGGAGGCGGAGG + Intronic
1044586436 8:93873137-93873159 CACTTGAACCCAGGAGACGGAGG + Intronic
1044651493 8:94500313-94500335 CACTTGAACCCAGGAGACGGAGG + Intronic
1044816268 8:96116534-96116556 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1045041021 8:98224840-98224862 CACTTGAACCCAGGAGACGGAGG - Intronic
1045339685 8:101242491-101242513 CACATGAACCCAGGAGGCGGAGG - Intergenic
1045533847 8:103008754-103008776 CACTTGAACCCAGGAGACGGAGG - Intergenic
1045690520 8:104755251-104755273 CACTTGAACCCAGGAGACGGAGG + Intronic
1045856814 8:106773733-106773755 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1046923678 8:119763644-119763666 CACTTGAACCCAGGAGACGGAGG + Intronic
1047114355 8:121824015-121824037 CACTTGAACCCAGGAGACGGTGG - Intergenic
1047205303 8:122798420-122798442 CACATCCTGCCAGGGAATGGTGG + Intronic
1047272679 8:123377005-123377027 CACTTGAAGCCAGGGGGCGGAGG + Intronic
1047358018 8:124141722-124141744 CACATACAGCCAGGGGTAGGGGG - Intergenic
1047441571 8:124883544-124883566 CACTTGAACCCAGGAGACGGAGG - Intergenic
1047505692 8:125477695-125477717 CACTTGAACCCAGGAGACGGAGG - Intergenic
1048036653 8:130683592-130683614 CACCTGAACCCAGGGGCCGGAGG - Intergenic
1048716470 8:137276602-137276624 CACTTGAACCCAGGAGACGGAGG - Intergenic
1050035632 9:1432931-1432953 CACTTCAAGCCAGGAGGCAGAGG + Intergenic
1050126198 9:2358548-2358570 CACTTCAACCCAGGAGATGGAGG - Intergenic
1050440170 9:5653679-5653701 CACTTGAACCCAGGAGACGGAGG - Intronic
1050958111 9:11690110-11690132 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1051414153 9:16821147-16821169 CACTTCAACCCAGGAGGCGGAGG + Intronic
1051577504 9:18633503-18633525 CACTTGAACCCAGGGGGCGGAGG + Intronic
1052589317 9:30471020-30471042 CACTTGAACCCAGGAGACGGAGG - Intergenic
1052761249 9:32594400-32594422 CACTTGAACCCAGGAGACGGAGG - Intergenic
1052897552 9:33761793-33761815 CACTTGAACCCTGGGGACGGAGG + Intronic
1052923769 9:33995271-33995293 CACTTGAACCCAGGAGACGGAGG + Intronic
1053257434 9:36629926-36629948 CACTTGAACCCAGGAGACGGAGG - Intronic
1053423015 9:37992315-37992337 CACTTCAACCCAGGAGGCGGAGG + Intronic
1053655274 9:40213133-40213155 CACTTGAACCCAGGAGACGGAGG - Intergenic
1054367391 9:64359347-64359369 CACTTGAACCCAGGAGACGGAGG - Intergenic
1054529325 9:66163182-66163204 CACTTGAACCCAGGAGACGGAGG + Intergenic
1054675018 9:67849086-67849108 CACTTGAACCCAGGAGACGGAGG - Intergenic
1054986585 9:71268736-71268758 CACTTGAACCCAGGGAACGGAGG + Intronic
1054999976 9:71437782-71437804 CACTTGAACCCAGGGGGCGGGGG + Intronic
1055220595 9:73926495-73926517 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1055444127 9:76365925-76365947 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1056185058 9:84126227-84126249 GACCTCAAGTCAGGGAACGGTGG + Intergenic
1056393151 9:86156986-86157008 CACTTGAACCCAGGAGACGGAGG + Intergenic
1056407207 9:86286100-86286122 CACTTGAACCCAGGAGACGGAGG - Intergenic
1056438229 9:86594419-86594441 CACTTGAACCCAGGGGACAGAGG - Intergenic
1056871564 9:90286590-90286612 CACTTGAACCCAGGAGACGGAGG - Intergenic
1057403442 9:94744615-94744637 CACTTCAACCCAGGAGACGGAGG + Intronic
1057595669 9:96414559-96414581 CACATGAACCCTGGAGACGGAGG - Intronic
1057696594 9:97327083-97327105 CACTTGAACCCAGGAGACGGAGG + Intronic
1057718972 9:97517471-97517493 CAAACCAGGCCAGGGGAGGGTGG + Intronic
1057741800 9:97718587-97718609 CACATGAACCCAGGAGGCGGAGG - Intergenic
1058369864 9:104253858-104253880 CACTTGAACCCAGGAGACGGAGG - Intergenic
1058466916 9:105237903-105237925 CACATGAACCCAGGGGGTGGAGG + Intergenic
1059004894 9:110391557-110391579 CACATCAAGGCCGGGCATGGTGG - Intronic
1059133038 9:111775077-111775099 CACTTGAACCCAGGGGACGGAGG - Intronic
1059478448 9:114568772-114568794 CACTTGAACCCAGGAGACGGAGG + Intergenic
1059646545 9:116273688-116273710 CACTTGAACCCAGGAGACGGAGG + Intronic
1060094172 9:120772407-120772429 CACTTGAACCCAGGGGGCGGAGG + Intronic
1060245711 9:121944422-121944444 CACTTGAATCCAGGGGGCGGAGG + Intronic
1060395728 9:123315110-123315132 CACTGCAATCCAGGAGACGGAGG - Intergenic
1060545255 9:124455504-124455526 CACTTAAACCCAGGGGGCGGAGG + Intronic
1060699148 9:125735714-125735736 CACTTGAAGCCAGGAGGCGGAGG - Intergenic
1061031324 9:128085245-128085267 CACTTGAAGCCAGGAGGCGGAGG + Intronic
1061251067 9:129426740-129426762 CACATGAACCCAGGAGACAGAGG - Intergenic
1061359627 9:130132700-130132722 CACTTGAACCCAGGAGACGGAGG + Intronic
1061561730 9:131408801-131408823 CACTTCAACCCAGGAGGCGGAGG - Intronic
1061852574 9:133424614-133424636 CACCTCCACCCAGGGGAGGGAGG - Intronic
1062215563 9:135387639-135387661 CAAGACAAGCAAGGGGACGGAGG - Intergenic
1062594192 9:137290514-137290536 CACTTGAAGCCAGGAGACAGAGG - Intergenic
1062595372 9:137296748-137296770 CACAGCAGGCCAGAGGAGGGTGG - Intergenic
1062737727 9:138147597-138147619 CCCGTCAAGGCAGGGGATGGCGG + Intergenic
1185448695 X:271771-271793 CACATCACACCAGGACACGGAGG + Intergenic
1185448720 X:271869-271891 CACATCACACCAGGACACGGAGG + Intergenic
1185448800 X:272212-272234 CACATCACACCAGGACACGGAGG + Intergenic
1185448813 X:272261-272283 CACATCACACCAGGACACGGAGG + Intergenic
1185448988 X:272994-273016 CACATCACACCAGGACACGGAGG + Intergenic
1185449199 X:273832-273854 CACATCACACCAGGACACGGAGG + Intergenic
1185449332 X:274371-274393 CACATCACACCAGGACACGGAGG + Intergenic
1185449356 X:274469-274491 CACATCACACCAGGACACGGAGG + Intergenic
1185449427 X:274763-274785 CACATCACACCAGGACACGGAGG + Intergenic
1185674980 X:1841852-1841874 CACTTCAACCCAGGAGGCGGAGG + Intergenic
1185690864 X:2154259-2154281 CACTTGAACCCAGGAGACGGAGG - Intergenic
1185743366 X:2551888-2551910 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1187435293 X:19262459-19262481 CACTTCAACCCAGGAGGCGGAGG - Intergenic
1187884325 X:23875164-23875186 CACTTCAATCCAGGAGGCGGAGG + Intronic
1188734538 X:33696202-33696224 CGCTTTAACCCAGGGGACGGAGG + Intergenic
1189184017 X:39036045-39036067 CTCATCAAACCAGGGGAGAGTGG - Intergenic
1189514080 X:41693528-41693550 CGCTTGAAGCCAGGGGGCGGAGG + Intronic
1189787903 X:44576309-44576331 CACTTGAACCCAGGGGGCGGAGG - Intergenic
1190068026 X:47256185-47256207 CACTTGAACCCAGGGGACAGAGG - Intergenic
1190256610 X:48767624-48767646 CACATGAACCCAGGAGGCGGAGG + Intronic
1190278913 X:48917069-48917091 CACTTGAACCCAGGAGACGGAGG + Intronic
1190306615 X:49086675-49086697 CACTTGAACCCAGGAGACGGAGG - Intronic
1192424321 X:71061647-71061669 CACTTGAACCCAGGAGACGGAGG + Intronic
1192474682 X:71430091-71430113 CACATCTAGGCCGGGCACGGTGG + Intronic
1193551334 X:82896464-82896486 AACATCAAGGCCGGGCACGGGGG - Intergenic
1193803123 X:85961334-85961356 CACTTGAACCCAGGAGACGGAGG + Intronic
1194201176 X:90954393-90954415 CACTTAAACCCAGGAGACGGAGG - Intergenic
1195287357 X:103398032-103398054 CACATCAAGGAAGAGGACGGTGG - Intergenic
1195904409 X:109829555-109829577 CGCTTGAAGCCAGGAGACGGAGG + Intergenic
1196259348 X:113559776-113559798 CACTTGAACCCAGGGGGCGGAGG + Intergenic
1197821734 X:130548032-130548054 AAAATCAAGCCAGAGGAAGGAGG - Intergenic
1198017945 X:132630859-132630881 CACTTGAACCCAGGAGACGGAGG + Intronic
1198181843 X:134217835-134217857 CACTTGAATCCAGGGGGCGGAGG - Intergenic
1198320993 X:135519196-135519218 CACTTCAACCCAGGAGACGGAGG - Intergenic
1198475259 X:136990695-136990717 CACTTGAACCCAGGAGACGGAGG - Intergenic
1198706153 X:139450683-139450705 CACATAACTCCAGGGGACAGGGG + Intergenic
1198763678 X:140060093-140060115 CACTTCAACCCAGGAGATGGAGG - Intergenic
1199089105 X:143670667-143670689 CGCATGAACCCAGGAGACGGAGG - Intergenic
1199992203 X:152993626-152993648 CACTTGAACCCAGGGGGCGGAGG - Intronic
1200248653 X:154540552-154540574 CACTTGAATCCAGGAGACGGAGG + Intronic
1200547022 Y:4529849-4529871 CACTTAAACCCAGGAGACGGAGG - Intergenic
1201228009 Y:11836564-11836586 CACTTCAACCCAGGAGACAGAGG - Intergenic
1201234743 Y:11898316-11898338 CACCTCCAGCCAGTGGACGCAGG + Intergenic
1201280302 Y:12336575-12336597 CACGTCAACCCAGGAGGCGGAGG + Intergenic
1201941454 Y:19464942-19464964 CACATATAGGCAGGGAACGGTGG + Intergenic