ID: 1084546836

View in Genome Browser
Species Human (GRCh38)
Location 11:69818897-69818919
Sequence GCTGCTACTGCTCAGCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084546836_1084546838 -4 Left 1084546836 11:69818897-69818919 CCAGCAGGCTGAGCAGTAGCAGC 0: 1
1: 0
2: 3
3: 26
4: 343
Right 1084546838 11:69818916-69818938 CAGCCAGATTAGGCCCATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 39
1084546836_1084546843 18 Left 1084546836 11:69818897-69818919 CCAGCAGGCTGAGCAGTAGCAGC 0: 1
1: 0
2: 3
3: 26
4: 343
Right 1084546843 11:69818938-69818960 GCATCGCGCCCGCCCCGCGGCGG 0: 1
1: 0
2: 22
3: 23
4: 114
1084546836_1084546845 24 Left 1084546836 11:69818897-69818919 CCAGCAGGCTGAGCAGTAGCAGC 0: 1
1: 0
2: 3
3: 26
4: 343
Right 1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG 0: 1
1: 0
2: 11
3: 90
4: 647
1084546836_1084546842 15 Left 1084546836 11:69818897-69818919 CCAGCAGGCTGAGCAGTAGCAGC 0: 1
1: 0
2: 3
3: 26
4: 343
Right 1084546842 11:69818935-69818957 GTGGCATCGCGCCCGCCCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 118
1084546836_1084546844 21 Left 1084546836 11:69818897-69818919 CCAGCAGGCTGAGCAGTAGCAGC 0: 1
1: 0
2: 3
3: 26
4: 343
Right 1084546844 11:69818941-69818963 TCGCGCCCGCCCCGCGGCGGCGG 0: 1
1: 0
2: 20
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084546836 Original CRISPR GCTGCTACTGCTCAGCCTGC TGG (reversed) Exonic
900306722 1:2013570-2013592 GCTGCCACAGCTGAGCCTGGAGG - Intergenic
900562147 1:3312481-3312503 GCCGCTCCTCCCCAGCCTGCTGG + Intronic
900599878 1:3498393-3498415 GCTGCCTCTGCCCAGCCGGCTGG - Exonic
900878365 1:5362571-5362593 GCTCCTGATGCTCAGCCTACAGG - Intergenic
901018116 1:6243064-6243086 GCAGCTACAGTTCAGCCTCCTGG + Intergenic
902209359 1:14893587-14893609 ACTGCTACTGCTCTCCCTACAGG + Intronic
902314152 1:15604902-15604924 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
902425460 1:16317811-16317833 GATCCTCCTGCTCAGCCTCCTGG - Intronic
902944571 1:19825526-19825548 GCTGGCACTGCTGGGCCTGCAGG + Intergenic
903125641 1:21245569-21245591 GCTCCTACTGCCCCACCTGCAGG + Intronic
905848909 1:41258333-41258355 GCTGTTTCTGCTCAGCCCCCTGG + Intergenic
906383755 1:45349375-45349397 GCTGCGAGTGCTGAGCCAGCAGG - Intronic
906661182 1:47583430-47583452 GTGGGTGCTGCTCAGCCTGCAGG - Intergenic
907617988 1:55944242-55944264 GCAGCTACTGCTAAACCAGCAGG + Intergenic
910259779 1:85283933-85283955 GCAGGTACTTCTGAGCCTGCAGG - Intergenic
910885913 1:91963214-91963236 GATTCTCCTGCTCAGCCTCCTGG - Intronic
911149147 1:94580329-94580351 ACTGATGCTGCTCAGCCTCCTGG + Intergenic
912324514 1:108745243-108745265 GCTACGACTCCTCAGCTTGCAGG + Intergenic
913486478 1:119336283-119336305 GCTGCTCCTGTTCACCATGCAGG - Intergenic
914950864 1:152112325-152112347 GCTGCTGCTGCTCTTCCTCCTGG + Exonic
915431142 1:155868053-155868075 TCTGCTTCTTCTCTGCCTGCTGG - Exonic
916081482 1:161235884-161235906 GGCGCCACTGCCCAGCCTGCAGG - Exonic
916691592 1:167195107-167195129 GCTGCTTCTGCTCAACTTCCTGG - Intergenic
917293631 1:173495748-173495770 TTTGCTACTGACCAGCCTGCTGG - Intergenic
917534657 1:175865523-175865545 GCTTCTTCTGCTCAGACAGCAGG - Intergenic
919724776 1:200874346-200874368 GCTGTTCCCTCTCAGCCTGCAGG + Intergenic
920255079 1:204649212-204649234 CCTGCTGCTGCTCAGGATGCAGG + Intronic
920363616 1:205436333-205436355 GCAGCTACCGCTCACCCTCCTGG + Intronic
921945693 1:220884553-220884575 GCTGCTGCTACTAAGACTGCTGG - Exonic
923548297 1:234940939-234940961 GATGCTGCTGCTCAGACTGGAGG - Intergenic
923936278 1:238763878-238763900 GCAGCTACTGCTGCGGCTGCTGG - Intergenic
1063044242 10:2375966-2375988 GCGGCTCCTGGTCAGCCAGCTGG + Intergenic
1063365244 10:5486634-5486656 GCTGCCTCTCCTCCGCCTGCAGG - Intergenic
1063429623 10:5977414-5977436 GCTGCTGCTGCTCCGGCCGCCGG - Exonic
1064000642 10:11661330-11661352 GCTGCTTCTGCTCTGCTTCCTGG - Intergenic
1065861978 10:29879492-29879514 GCTGCTATTGGTTAGCCTGGTGG - Intergenic
1066067336 10:31771944-31771966 CCTGGTGCTGCTCAGCCTGCAGG + Intergenic
1067712852 10:48664151-48664173 GCTCTGACAGCTCAGCCTGCTGG - Intergenic
1068652362 10:59536755-59536777 GCTGCAGCTTTTCAGCCTGCTGG + Intergenic
1069739041 10:70675767-70675789 GCTGCTCCTCCTCAGTGTGCAGG + Intronic
1070850126 10:79556767-79556789 GCCGGTACTGCTCATCCTGATGG + Exonic
1070854378 10:79594858-79594880 GCTGGGACTGCTCATCCTGATGG + Intergenic
1071388152 10:85142293-85142315 GTTGCTACTGCTCACTCTTCGGG + Intergenic
1074149159 10:110742701-110742723 ACTGCTACTGTTCAGGCAGCTGG + Intronic
1075884227 10:125883590-125883612 GCTGCTTCTGCTCAGTTGGCTGG - Intronic
1076572867 10:131444023-131444045 GATTCTCCTGCCCAGCCTGCTGG - Intergenic
1076762038 10:132610707-132610729 GCTGCCACGGCCCAGCCTGTGGG - Intronic
1077259387 11:1607756-1607778 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077259401 11:1607843-1607865 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077259420 11:1607960-1607982 GCTGCTGCTCCTCAGGCTGTGGG - Exonic
1077262542 11:1630328-1630350 GCTGCTGCTCCTCAGGCTGTGGG + Exonic
1077585525 11:3449041-3449063 ACAGCTACTGCTGCGCCTGCTGG - Intergenic
1078434633 11:11314252-11314274 ACTGCTTCTCCCCAGCCTGCAGG + Intronic
1078466645 11:11554940-11554962 GCTGGTCCTGCGCAGCCTCCTGG + Intronic
1082028870 11:47590783-47590805 GCCGCTTCTGCTGGGCCTGCTGG - Exonic
1083680926 11:64351568-64351590 GCTGCTGCTGCAGAGCCAGCGGG + Exonic
1084171052 11:67401322-67401344 GCTGTTGCTGCTGAGCCTCCCGG + Intronic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084314468 11:68336981-68337003 GATGCCACAGCTCAGCCAGCAGG - Intronic
1084546836 11:69818897-69818919 GCTGCTACTGCTCAGCCTGCTGG - Exonic
1084798825 11:71527602-71527624 GCTGCTGCTCCTCAGGCTGTGGG + Exonic
1084806449 11:71582544-71582566 GCTGCTCCTCCTCAGGCTGTGGG - Exonic
1085576618 11:77610704-77610726 GCTGCACCTGTTCAGTCTGCAGG - Intronic
1087564154 11:99832887-99832909 GCTGCAACTGTTCTGCCTGCTGG - Intronic
1089140925 11:116283293-116283315 GTTGCCAGTGCTCAGCCTGCAGG + Intergenic
1089865459 11:121627625-121627647 CCTGATACTGCTGAGCCTGGGGG + Exonic
1090041836 11:123298807-123298829 GCAGGTACTTCTGAGCCTGCGGG - Intergenic
1090306912 11:125699135-125699157 CGTGCTCCTGCTGAGCCTGCAGG + Intergenic
1090580901 11:128157820-128157842 GCTGTTACAGCTCCACCTGCTGG - Intergenic
1091321832 11:134657314-134657336 GCTGCTGCTGCTCAAGCTCCGGG - Intergenic
1091450468 12:569480-569502 GCTGCTACTGCACAAACTGGAGG - Intronic
1091457313 12:617642-617664 GCTGGGAGTGCTCAGCCAGCCGG - Intronic
1091600596 12:1915608-1915630 GCTGCCACTGCTGAGCCTGAGGG + Intronic
1091849045 12:3680316-3680338 GGAGCTACCGCTCAGCCTGGAGG - Exonic
1093612753 12:21182596-21182618 GCCTCCACTGCTCAGCCTGAGGG + Intronic
1093729339 12:22549770-22549792 GCTGGTACTGCAAAGCCTGCAGG + Intergenic
1094687972 12:32737916-32737938 GCTGCTTCTGCTGAGGCTGATGG + Exonic
1100667502 12:96770929-96770951 GATGCTTCTAGTCAGCCTGCTGG + Intronic
1101422605 12:104562009-104562031 GCTCCTACTGCCCAGTCTCCTGG + Intronic
1101675875 12:106915715-106915737 GCTCCTACTCCTCTGTCTGCTGG + Intergenic
1102770095 12:115468343-115468365 TCTGCCACAGCACAGCCTGCTGG + Intergenic
1104021252 12:124993853-124993875 GCTGCTGCTGCTCGGGCTGCTGG + Exonic
1104640656 12:130464872-130464894 GCTGGGCCTGCTCGGCCTGCAGG - Intronic
1104873700 12:132018336-132018358 GCTGCTGCTGGTCGGGCTGCTGG - Exonic
1105699983 13:22928293-22928315 ACTGCTTCTGGTCAGCCTTCTGG + Intergenic
1106265713 13:28107736-28107758 GCTGCTGCTGCTGTGCCAGCTGG - Intergenic
1107899258 13:44995832-44995854 GCTGCTGCTGCTGGTCCTGCTGG + Intronic
1114647885 14:24265695-24265717 GCTGGTCCTCCTCAACCTGCAGG - Exonic
1116203480 14:41830761-41830783 GCTGCTCCTGCTCTGTCTCCTGG + Intronic
1116297768 14:43135391-43135413 GTTGCTGCTGCTCAGTCTTCGGG - Intergenic
1118262506 14:64260581-64260603 GCAGCTAGTGCTCACCCTCCTGG - Exonic
1118957527 14:70496918-70496940 GCTGTTGCTGCTCAGCCCCCTGG - Intergenic
1119284334 14:73439899-73439921 GCTGCTATTTCTCTGCCTACTGG - Intronic
1119651491 14:76387094-76387116 GCTGCTTCCCCTCAGCCTCCTGG - Intronic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1120624968 14:86813772-86813794 CCTGCTTCTGCTCATCCTCCGGG + Intergenic
1120704620 14:87734207-87734229 GCTGCTGCTGCTCAGTCTTTGGG - Intergenic
1121755767 14:96400832-96400854 TCAGATACTCCTCAGCCTGCGGG - Intronic
1121874633 14:97440111-97440133 GCTGCTACTGCTCCTGCTGGAGG - Intergenic
1122396897 14:101440046-101440068 GCTGCAACTGACCTGCCTGCAGG + Intergenic
1122774266 14:104110293-104110315 GCTGCTAGTCCTCCTCCTGCTGG - Intronic
1122797187 14:104211938-104211960 GCGGCTCCGGCTCAGCCTCCAGG - Intergenic
1122811211 14:104290255-104290277 GCTGCTGCTTCTCAGCCCCCAGG + Intergenic
1122967470 14:105138054-105138076 GCTGCTGCTGCCTGGCCTGCAGG + Intergenic
1123183286 14:106489737-106489759 GCTACTCCTTCTCTGCCTGCTGG - Intergenic
1124076819 15:26454054-26454076 GCTGCTTCTGCTGAGGGTGCTGG - Intergenic
1124636332 15:31367155-31367177 GCTGCTCCTTGTCAGCCTCCTGG + Intronic
1125720249 15:41841900-41841922 GCTTCCACTGCCCAGCCTGCTGG + Exonic
1125727488 15:41875478-41875500 GCTCCTGCTGTCCAGCCTGCTGG + Exonic
1125815661 15:42581659-42581681 GCTGCTGCTGCTGAGGCTGCTGG - Intronic
1126119132 15:45235667-45235689 GCTGCTCCTGCTGCTCCTGCTGG - Intergenic
1128251922 15:66169803-66169825 GGTGCTCCTGCTCCGCCTGCGGG - Intronic
1129140112 15:73590176-73590198 CCTGCTTCTGCCCAGCCTGTAGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131465593 15:92652786-92652808 TCTGCAACTCCTTAGCCTGCGGG - Intronic
1132511652 16:345374-345396 CCTGCTATTTCTCAGCCTGTAGG + Intronic
1132590558 16:724574-724596 CCCGGCACTGCTCAGCCTGCTGG - Intronic
1133137991 16:3725532-3725554 GCTGCCACTGCTCGGCCTGCTGG - Exonic
1133916332 16:10112853-10112875 GCTGCTTCTGGTAAGCGTGCAGG - Intronic
1134212565 16:12289933-12289955 GCTGCATGAGCTCAGCCTGCAGG + Intronic
1136099783 16:27985460-27985482 TCTGCTTCTGCTGAGACTGCAGG - Intronic
1136156108 16:28383331-28383353 CCTGCTGCTGCGCAGCCTGCAGG - Exonic
1136206978 16:28731957-28731979 CCTGCTGCTGCGCAGCCTGCAGG + Exonic
1136775785 16:32871073-32871095 GCTTCTGCAGCTCAGCCTTCAGG - Intergenic
1136894832 16:33990439-33990461 GCTTCTGCAGCTCAGCCTTCAGG + Intergenic
1137705947 16:50535948-50535970 GCTGCTCCTGCTAAGCCACCCGG + Intergenic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1138605662 16:58086620-58086642 GCTGCTCCTCCTCTGCCTGTAGG - Intergenic
1138741840 16:59320013-59320035 CCTCCCACTGCTCAGACTGCAGG - Intergenic
1139578695 16:67858848-67858870 GTTGCTGCTGCTCTGCCTTCAGG + Intronic
1141324414 16:83042306-83042328 GCTGCTACTGATCTGACAGCAGG - Intronic
1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG + Intergenic
1142409847 16:89910454-89910476 GCTGCTGCTGCTCTGCCCCCTGG + Intronic
1203078201 16_KI270728v1_random:1133182-1133204 GCTTCTGCAGCTCAGCCTTCAGG - Intergenic
1142685669 17:1575732-1575754 GCTGCTCCTTCTCAGCCTGCTGG - Exonic
1143294717 17:5862213-5862235 GCCACTGCTGCTCGGCCTGCAGG - Intronic
1143321324 17:6070765-6070787 GCTGCACCTGCTCCGGCTGCAGG + Intronic
1144359177 17:14475518-14475540 GATGCTATTGCTCAGCCCCCAGG + Intergenic
1144992597 17:19243954-19243976 GTTCCTACTGCACAGCCAGCAGG - Intronic
1146393771 17:32445126-32445148 GCTGCTACTCCTCAGCCCCACGG + Intronic
1146496282 17:33325358-33325380 ACAGCTTCTGTTCAGCCTGCAGG - Intronic
1146652111 17:34613392-34613414 GCTGCTCCTGCTTAGCTGGCTGG + Intronic
1147215076 17:38894181-38894203 ACTGCCTCTGCTCAGCCTGGGGG - Intronic
1147649581 17:42054266-42054288 GCTGGTCCTGCTCTGCCTGCTGG + Intronic
1148782606 17:50130127-50130149 GCAGCTACTTCTCTGCCCGCGGG + Intergenic
1148880439 17:50721734-50721756 GCTGTTAGTGCTAAACCTGCAGG + Intronic
1151384461 17:73746662-73746684 GCTGCTGCTGCTCAGGCCCCAGG + Intergenic
1151395692 17:73821241-73821263 GCTTCCAATGCCCAGCCTGCAGG + Intergenic
1151492721 17:74442458-74442480 CCTGCTCTTCCTCAGCCTGCTGG + Intronic
1151541687 17:74767927-74767949 GGTTCTACTGCTCAGGCTGGAGG - Intronic
1151786477 17:76277426-76277448 GCCCCTGCTGCTCAGCCTCCCGG - Intronic
1152034760 17:77865355-77865377 GCTGCTCCTACGCAGGCTGCTGG - Intergenic
1152092136 17:78252876-78252898 GATGCTTCCACTCAGCCTGCAGG + Intergenic
1152099032 17:78290338-78290360 GCCGCTGCCGCCCAGCCTGCAGG - Intergenic
1152100564 17:78299437-78299459 ACTGCAGCGGCTCAGCCTGCAGG - Intergenic
1152289238 17:79429456-79429478 CCTCCTCCTGCCCAGCCTGCTGG - Intronic
1152394504 17:80024062-80024084 GCCGCTTCTGCTTAGCCGGCCGG - Intronic
1152422986 17:80204046-80204068 GCAGCCCCTGCCCAGCCTGCAGG + Intronic
1152574425 17:81133820-81133842 GATGCTAGAGCCCAGCCTGCTGG - Intronic
1152583328 17:81178590-81178612 GGTGCTGCGGCCCAGCCTGCGGG - Intergenic
1152630758 17:81409789-81409811 GCTGGCACAGCCCAGCCTGCTGG - Intronic
1152706022 17:81844129-81844151 GCTGCAACAGCTGAGGCTGCCGG + Intronic
1153794415 18:8609544-8609566 GCTGCAACTGCGCCGCCGGCCGG - Exonic
1154410822 18:14141267-14141289 GCTGTGACAGCCCAGCCTGCAGG - Intergenic
1155652451 18:28158358-28158380 TCTGCAACCTCTCAGCCTGCAGG - Intronic
1156779722 18:40837010-40837032 GCAGCTACTGATCAACCTTCAGG + Intergenic
1156785229 18:40904494-40904516 GCTGCTAAAACTCAGCATGCTGG - Intergenic
1158578094 18:58657315-58657337 GCTTCTTCTGCACAGCCTGTGGG + Intergenic
1160182535 18:76647891-76647913 GCTGCTGCTGCTCAGCCCTCTGG + Intergenic
1160294146 18:77622463-77622485 GCTGATCATGCTCAGCCTCCGGG + Intergenic
1161456352 19:4371606-4371628 GCTGCTGTGGCCCAGCCTGCAGG + Intronic
1161607269 19:5222101-5222123 GGTGCGACTGCCCAGCCAGCAGG - Exonic
1161800745 19:6415719-6415741 GCTGCAGCTGCTTTGCCTGCAGG + Exonic
1162062987 19:8108027-8108049 GGTCCTGCTGCTCAGCCTCCAGG + Intronic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1165472043 19:36009496-36009518 GCTGGAACCGCGCAGCCTGCTGG - Exonic
1165718720 19:38063720-38063742 GCTGCTATGACCCAGCCTGCGGG - Intronic
1167277975 19:48550338-48550360 GCTCCCACAGCTCAGCCTCCTGG + Intergenic
1167285536 19:48596867-48596889 GCTGCTGCCTCCCAGCCTGCTGG + Exonic
1167560739 19:50225578-50225600 GCCGCTCCAGCTCACCCTGCCGG - Exonic
1168105671 19:54164502-54164524 GCGGGTGCTGCTCAACCTGCTGG - Exonic
1168169068 19:54574386-54574408 GATGGTACTCCTCAGCCTGAAGG - Exonic
925514843 2:4669890-4669912 GCTGATACTGTTCAGCCTCAAGG - Intergenic
925919549 2:8629487-8629509 GCTGGGAATGCACAGCCTGCTGG - Intergenic
926310262 2:11669865-11669887 GCTGCTGCTGGTCGGCGTGCCGG - Exonic
926778827 2:16448411-16448433 GCTTCCTCTGCTCAGCCTGCTGG - Intergenic
927690475 2:25204542-25204564 GCAGCCTCTGCTCACCCTGCAGG - Intergenic
927845576 2:26470706-26470728 CCTTCTCCTCCTCAGCCTGCAGG + Exonic
927963534 2:27255359-27255381 GCTGATACTGCTCGACCTGCAGG + Exonic
928605951 2:32945771-32945793 GCAGCTAGTGCTCAGGCAGCTGG + Intergenic
932449831 2:71802340-71802362 TCTGCTTCTGCGCAGTCTGCAGG + Intergenic
932732057 2:74228249-74228271 CCTAAAACTGCTCAGCCTGCAGG + Intronic
933448104 2:82408644-82408666 GCTGCTCCTGCTTTGCCTTCTGG - Intergenic
935618305 2:105108088-105108110 GATGCTACTGCCCTGCCTGCAGG - Intergenic
935834460 2:107036134-107036156 GCTGTTGCTGCTCAGCCCCCTGG + Intergenic
936023172 2:109010886-109010908 GCTGCTACAGGTGAGCCTACAGG + Intergenic
936661342 2:114547310-114547332 GCTGCTGCTGCTGCCCCTGCAGG + Intronic
937098263 2:119249563-119249585 CCTGCTCCTGCTCAGAATGCAGG + Intronic
940048697 2:149437735-149437757 GCTCCTGCTCCTGAGCCTGCTGG + Exonic
941327843 2:164139978-164140000 GCTGCTGCTGCTCTGACAGCAGG + Intergenic
944890752 2:204114997-204115019 GCTGCTTCTGCTCTGCCTTGAGG + Intergenic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
946359570 2:219210966-219210988 GAGGCTGCTGCTCAGGCTGCAGG - Exonic
947653493 2:231807573-231807595 GCTGCCTCTGCTCAGCGTGAGGG - Exonic
947788547 2:232847490-232847512 GCTGCTGCTGCTGACGCTGCTGG - Exonic
948436094 2:237955704-237955726 GCTGCCGGTGCTCAGCCTTCAGG + Intergenic
948677582 2:239607850-239607872 GTTGCTGGTTCTCAGCCTGCTGG + Intergenic
948692184 2:239713092-239713114 GGTGCTATTTCTCAGCCTTCTGG + Intergenic
1168996783 20:2139121-2139143 TCCCCTACTCCTCAGCCTGCAGG - Intronic
1169066086 20:2694672-2694694 GCTGCAACAGCTCAGACTTCTGG - Intronic
1169130668 20:3164990-3165012 GGAGCAGCTGCTCAGCCTGCGGG - Exonic
1169213045 20:3778217-3778239 GCTGCTTACGCTCCGCCTGCTGG + Exonic
1171191767 20:23164071-23164093 GCTGCAACTGCTCTACCTACAGG - Intergenic
1171386340 20:24771722-24771744 GTTGCTCCTGCTCACCCTGCCGG - Intergenic
1172033049 20:31995215-31995237 AGTGCTGCAGCTCAGCCTGCTGG + Exonic
1172227082 20:33312169-33312191 GCTGCTGCTGCTAAGACAGCAGG - Intergenic
1172389588 20:34558135-34558157 GCTGCTTCCGATCAGCCTCCAGG + Intronic
1173250369 20:41361285-41361307 GCCGCACCTGCTCAGCCAGCTGG + Exonic
1174157790 20:48528044-48528066 GCGGCTCCTCCTCAGGCTGCAGG + Intergenic
1174520534 20:51126775-51126797 TCTGCCACTGCTCAGACAGCAGG + Intergenic
1175210976 20:57354509-57354531 GCTGCTACTGCTAGTCCTGGTGG + Intronic
1175524559 20:59624555-59624577 GCTGCTCCTGTGTAGCCTGCAGG + Intronic
1175758869 20:61547697-61547719 GCTGCTCCTGCGCTGTCTGCAGG - Intronic
1176862235 21:14017152-14017174 GCTGTGACAGCCCAGCCTGCAGG + Intergenic
1178849365 21:36200424-36200446 GCTGCTCCTGCCCAGTCTGCAGG + Exonic
1181010685 22:20038730-20038752 GCTGCTTCTGCTCTGCCTGTGGG + Intronic
1181340924 22:22179225-22179247 GCAGCCACTGCTCAGGGTGCAGG - Intergenic
1181343192 22:22199085-22199107 GATGTTACTGCTCAGGGTGCAGG - Intergenic
1181358761 22:22318971-22318993 GAAGCCACTGCTCAGCATGCAGG - Intergenic
1181512361 22:23394630-23394652 GCTGCTGCTGGGCACCCTGCTGG + Intergenic
1182522306 22:30891434-30891456 GCTGCCACTGCTGAGGCTCCTGG - Intronic
1183217290 22:36489331-36489353 GCTGCTCGAGATCAGCCTGCTGG + Exonic
1184045337 22:41969526-41969548 TCAGCTCCTGCTCAGCCTCCAGG - Intergenic
1184252051 22:43266358-43266380 GCTGCTACTGCCTGGCCTGGGGG + Intronic
1184454316 22:44600514-44600536 GCTGCTTCTTCTGAGCCTTCAGG - Intergenic
1184600837 22:45542452-45542474 TCTGCTACTGCCCAGCCAGGCGG + Intronic
1185249273 22:49791248-49791270 GCGGCTACGGCAGAGCCTGCGGG + Intronic
1185298135 22:50064147-50064169 GCTGCTAGTGCTCCTGCTGCAGG - Exonic
950014317 3:9745113-9745135 GCTGCTACTGCTACTGCTGCTGG - Exonic
952403634 3:32986171-32986193 GCTGCTCCTGCTCATCGTTCAGG + Intergenic
954237912 3:49271115-49271137 GCTGCTTCTGCTCAGGCTCAAGG + Exonic
954814568 3:53270450-53270472 GCTCCTCCTGCACAGTCTGCAGG + Intergenic
955390270 3:58517532-58517554 GCAGCTGCTCATCAGCCTGCTGG - Intronic
959605517 3:108237195-108237217 GCTGTTACTGCTCAGCCCTCTGG + Intergenic
960685089 3:120287414-120287436 GCTGTTGCTGCTCAGCCCTCTGG - Intergenic
961447710 3:126988599-126988621 GCTGCCACCGCGGAGCCTGCAGG + Exonic
961834482 3:129645542-129645564 GCTCCTCCTTCTCAGCCCGCAGG + Intergenic
962378509 3:134878003-134878025 GCTCCTCCTGCTCTGCCTCCTGG + Intronic
962669739 3:137692974-137692996 GCAGCTGCTGCTCAGCTTCCAGG - Intergenic
962886057 3:139628937-139628959 GCTGCTACTGCTGACCCTAATGG + Intronic
966247674 3:177826579-177826601 GCTCCTCCTGCTCAGCCTTATGG + Intergenic
968404294 4:326776-326798 ACTGATGCTGCTCAGCCTCCTGG - Intergenic
968494831 4:909899-909921 GCAGCATCTCCTCAGCCTGCAGG + Intronic
968633512 4:1665666-1665688 CCTGCTCCTGCTGACCCTGCCGG - Intronic
969478570 4:7434843-7434865 GCTCCTCCTGCCCAGCCTCCTGG - Exonic
969580385 4:8061276-8061298 GCTGCACTTGCCCAGCCTGCAGG + Intronic
970424130 4:15930760-15930782 GCTCCTCCTGCTCAGGCTCCTGG - Intergenic
971709594 4:30093571-30093593 GTTGCTACTGCTCACTCTTCGGG + Intergenic
972355256 4:38274530-38274552 GCTGCCTCTGCTCTGCCAGCTGG - Intergenic
973567793 4:52205844-52205866 GTTGCTACTGTTCTTCCTGCTGG + Intergenic
975971495 4:80043742-80043764 GCTGTGACTGCCCTGCCTGCTGG + Intronic
977006495 4:91573345-91573367 GCTGTCACTGCTCAGCCCCCTGG + Intronic
978042928 4:104092322-104092344 GCTGTCACTGCTCAGCCCCCTGG - Intergenic
978137539 4:105280960-105280982 CCTGCTGCTTCTGAGCCTGCAGG + Intergenic
978557834 4:109999808-109999830 GCTGCTCCTCCTGAGCCTGTGGG + Exonic
981034190 4:140153021-140153043 GCTGCTCCACCTGAGCCTGCTGG + Exonic
981053149 4:140331627-140331649 GCTGCTGCTTCTCAGTCTCCTGG + Intronic
983826308 4:172266190-172266212 ACTGCTCCTGCTCAGGCTTCAGG - Intronic
985570163 5:640523-640545 GCTGCTGCTGCTCAGCAAGGCGG - Exonic
985575461 5:671604-671626 GCTGGTGCTGCCCGGCCTGCAGG + Intronic
985645649 5:1083592-1083614 GCTGCTGCTGATGAGCCTGGGGG - Intronic
985800198 5:2000920-2000942 GGTGTTACGGCACAGCCTGCAGG + Intergenic
987668211 5:20972967-20972989 GCTGCTACTTCTAAGGCTGAAGG - Intergenic
988494372 5:31732494-31732516 CCTCCTTCTGCTCAGCCTTCTGG - Intronic
989357362 5:40559673-40559695 GCTGCTACTGCTCAGAATCATGG - Intergenic
990955039 5:61332379-61332401 GCGGCTACAGCTCTGCCTGTCGG + Exonic
991173006 5:63650422-63650444 GCTGCTACTGTTTAGCTTGGTGG + Intergenic
991567717 5:68021765-68021787 GCTGCTGCTGCTGCGGCTGCTGG - Intergenic
991703188 5:69334210-69334232 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
992157732 5:73971542-73971564 GCGGCTCCTGCGCAGGCTGCAGG - Intergenic
992279079 5:75154827-75154849 GCTGCTCCTCCTCAGACTGTTGG + Intronic
992929357 5:81626554-81626576 GCTGATGCTGCTCAGACTGCTGG - Intronic
993329530 5:86580432-86580454 GCTGCTACATCCCAGCCTGGGGG + Intergenic
997201310 5:132011621-132011643 GCGGCTACTGCTGGGGCTGCTGG - Exonic
999330174 5:150668449-150668471 GCTGCTCCTGCCCAGGCTCCTGG + Intronic
1000932130 5:167264310-167264332 ACTGATACTGCTCACCCTGGTGG + Intergenic
1002181963 5:177435340-177435362 CCTGCTATGGCTGAGCCTGCAGG + Intronic
1005812739 6:29529414-29529436 ACTGCCACTGCCCAGCCTGATGG + Intergenic
1006154236 6:32005706-32005728 GCTGCTGCTGCTGCCCCTGCTGG + Intergenic
1006160540 6:32038440-32038462 GCTGCTGCTGCTGCCCCTGCTGG + Exonic
1006406519 6:33848822-33848844 ACTGCTACTGCTCCTCCTTCTGG + Intergenic
1008501463 6:52187608-52187630 GCTACTGCTGCTGAGCCTGGAGG + Exonic
1008556610 6:52678806-52678828 GCTGCTACTGCCCTGCCAGTGGG + Intronic
1008601015 6:53094771-53094793 GCTGCTGCTGCCCAGGCTCCAGG - Intronic
1009888698 6:69655490-69655512 ACTGTCACTGCTCAGCCTCCTGG - Intergenic
1011015547 6:82750634-82750656 GAGCCTACTGCTCAGCCTTCTGG + Intergenic
1011297571 6:85840554-85840576 GCTGTCACTGCTCAGCCTCCTGG - Intergenic
1011338613 6:86287223-86287245 GCTCTTATTGCTGAGCCTGCTGG + Intergenic
1015729427 6:136333203-136333225 GCTGCTACTGCTCATACATCAGG - Intergenic
1016502462 6:144736939-144736961 GCAGCTGCTGGTCATCCTGCCGG + Intronic
1016562111 6:145408271-145408293 GCTGTTACTGGTCATCCTCCTGG - Intergenic
1017046495 6:150351706-150351728 GATGCCACAGCTCAGCCTACAGG + Intergenic
1018263075 6:161989767-161989789 GATGGGCCTGCTCAGCCTGCCGG + Intronic
1019269897 7:140957-140979 TCAGGTCCTGCTCAGCCTGCAGG - Intergenic
1019321187 7:416054-416076 TCTGCTCCTGGGCAGCCTGCGGG - Intergenic
1020116164 7:5477778-5477800 GCTGCCACAGCGCTGCCTGCTGG + Intronic
1023886553 7:44361085-44361107 ACTGTCACTGCTCAGCCTCCGGG + Intergenic
1024024479 7:45399360-45399382 GCAGGTACTTCTGAGCCTGCAGG - Intergenic
1024043981 7:45575071-45575093 GCTGCCCGTGCGCAGCCTGCTGG + Exonic
1024053798 7:45646700-45646722 TCAGCTGCAGCTCAGCCTGCTGG + Intronic
1024996650 7:55277796-55277818 TCTGGTATTGCTCTGCCTGCAGG + Intergenic
1028477152 7:91265045-91265067 GCTGCTGCTGCTTTGGCTGCTGG + Exonic
1030073986 7:105721053-105721075 GTTGTTGCTGCTCAGCCTGTTGG - Intronic
1030855860 7:114556376-114556398 GCTGCTGCTGCTTCCCCTGCAGG + Intronic
1031127470 7:117791307-117791329 GCTGAAACGGCACAGCCTGCAGG + Exonic
1031529400 7:122857967-122857989 GTTGCTACTGCTCAGTCTTTGGG - Intronic
1032013033 7:128359379-128359401 GCCCCTGCTGCCCAGCCTGCGGG - Exonic
1033012703 7:137639613-137639635 GCTGCTGCTGTTGGGCCTGCTGG - Intronic
1033535140 7:142305388-142305410 GCAGCTGCTGGTCAACCTGCAGG + Intergenic
1034269515 7:149796851-149796873 GCTGCAGCTCCTCAGCATGCAGG - Intergenic
1034538447 7:151740384-151740406 GCTGCCACTGCTGTGCCTGAAGG - Intronic
1035477630 7:159154567-159154589 GCTGCTGCTGCTCATTCTGATGG + Intergenic
1035589596 8:802479-802501 GCTGCTGCTTCTCAACTTGCTGG + Intergenic
1036503935 8:9338051-9338073 GCTCCTCCAGCTCAGCCTCCTGG - Intergenic
1039048329 8:33470312-33470334 GATCCTCCTGCTCAGCCTCCTGG - Intronic
1043866688 8:85382984-85383006 GCTGGTGCTGCTGTGCCTGCCGG - Intronic
1045252181 8:100491454-100491476 GCTGGTACTGCTGGGACTGCAGG + Intergenic
1045830298 8:106451927-106451949 GCTGCTACTGCTCAAACAGTAGG + Intronic
1046392879 8:113600157-113600179 GCTGTTAGGGTTCAGCCTGCAGG - Intergenic
1048458333 8:134598549-134598571 GCTGCTGATGCTCGGCCTCCTGG - Intronic
1048888553 8:138928478-138928500 ACTGATACTGCTAAGCCAGCGGG - Intergenic
1049096216 8:140549815-140549837 GCTGCCACTCCTCAGGCTGCGGG - Intronic
1049195939 8:141315611-141315633 GCTTACACTGCTCATCCTGCCGG + Intergenic
1049280044 8:141739708-141739730 GCTGCTCCTGCCCAGCCTCGTGG + Intergenic
1049555039 8:143277450-143277472 GCTGGTACGGCTGGGCCTGCCGG + Intergenic
1050123873 9:2336266-2336288 GCTGTTACTGCACCCCCTGCTGG - Intergenic
1052626306 9:30981224-30981246 GCTGTCACTGCTCAGCCCCCTGG - Intergenic
1055552489 9:77444589-77444611 GCTGCTACAGGTCAGCAGGCTGG - Intronic
1055741236 9:79391618-79391640 GCTGCTGCTGCTGTGCCGGCTGG - Intergenic
1056128063 9:83555636-83555658 GCTATTACTGCTCAGCCCCCTGG + Intergenic
1056698090 9:88877874-88877896 GCTCCTGCTGATCAGCCAGCCGG - Intergenic
1057303446 9:93899500-93899522 ACTGCTGCTGCTCTGCCTGGAGG - Intergenic
1057489186 9:95508524-95508546 GCTGCTGCTGCTCACACGGCGGG + Exonic
1058668933 9:107344353-107344375 GCTGCTACTTCTCAGCCAGCTGG + Intergenic
1058818104 9:108704293-108704315 GGAGCTGCTGCTCAGCCTGTGGG - Intergenic
1059203677 9:112443388-112443410 GCTGCAATTGCACAGCCAGCAGG + Intronic
1059254302 9:112914715-112914737 GCTGGTCATGCTGAGCCTGCTGG - Intergenic
1060192274 9:121600429-121600451 GCTTCCAGTGCTCAGCCTGGTGG + Intronic
1060889090 9:127176979-127177001 TCTGCTCCTGCTCATCCTGTTGG + Intronic
1060970277 9:127733879-127733901 GCTGAAACTGATCAGCCTGGTGG + Intronic
1061478405 9:130884359-130884381 GCGGCTGCTGGTCAGCGTGCTGG - Exonic
1061681288 9:132243611-132243633 GCTGCCACTGCTCCACCTGCAGG + Exonic
1061922338 9:133788979-133789001 ACTGCCAATGCTCAGCCTCCAGG - Intronic
1061935143 9:133853356-133853378 AGTGCTGCTGCTCAGCCTGGGGG - Intronic
1062589308 9:137266345-137266367 CCTGCTGCTGCTCCGGCTGCTGG + Exonic
1203759603 EBV:5265-5287 GATGCTAATGTTCAGCCAGCGGG - Intergenic
1185761294 X:2691384-2691406 GCTGCTGCTCTTCGGCCTGCTGG + Exonic
1187507252 X:19887727-19887749 GCTCCTGCAGCTCCGCCTGCCGG + Intergenic
1191682293 X:63853496-63853518 TCTGCTGCTCCCCAGCCTGCAGG + Intergenic
1192107953 X:68334183-68334205 GCTGTTACAGCTCAGCATGGTGG - Intronic
1192254518 X:69443959-69443981 GCTGTTGCTGCTCAGCCCTCTGG + Intergenic
1192891671 X:75398074-75398096 GCTGTTACTGCTCAGCCCCCTGG - Intronic
1193715202 X:84928396-84928418 GCTGTCACTGCTCAGCCCCCTGG + Intergenic
1195369559 X:104159405-104159427 GCTGCTACTGCTAAGCAAACTGG + Intergenic
1196152928 X:112393826-112393848 ACTGTTGCTGCTCAGCCCGCTGG + Intergenic
1196735031 X:118975416-118975438 GCGGCTGCTGCCCAGCCCGCCGG - Exonic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1199307244 X:146280453-146280475 ACTGTTGCTGCTCAGCCTCCTGG + Intergenic
1199793663 X:151176672-151176694 GCTGCTGATCCTGAGCCTGCTGG + Exonic
1200182639 X:154160049-154160071 GCTGCTTCTGCTGCGGCTGCAGG - Intergenic
1200188293 X:154197163-154197185 GCTGCTTCTGCTGCGGCTGCAGG - Intergenic
1200193943 X:154234303-154234325 GCTGCTTCTGCTGCGGCTGCAGG - Intergenic
1200199698 X:154272107-154272129 GCTGCTTCTGCTGCGGCTGCAGG - Intronic