ID: 1084548167

View in Genome Browser
Species Human (GRCh38)
Location 11:69824848-69824870
Sequence TTGTCCTTTAAACTTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084548167_1084548171 29 Left 1084548167 11:69824848-69824870 CCTATTCTAAGTTTAAAGGACAA No data
Right 1084548171 11:69824900-69824922 CGCACCCCAGTCCCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084548167 Original CRISPR TTGTCCTTTAAACTTAGAAT AGG (reversed) Intergenic
No off target data available for this crispr