ID: 1084548171

View in Genome Browser
Species Human (GRCh38)
Location 11:69824900-69824922
Sequence CGCACCCCAGTCCCAACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084548166_1084548171 30 Left 1084548166 11:69824847-69824869 CCCTATTCTAAGTTTAAAGGACA No data
Right 1084548171 11:69824900-69824922 CGCACCCCAGTCCCAACACCAGG No data
1084548167_1084548171 29 Left 1084548167 11:69824848-69824870 CCTATTCTAAGTTTAAAGGACAA No data
Right 1084548171 11:69824900-69824922 CGCACCCCAGTCCCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084548171 Original CRISPR CGCACCCCAGTCCCAACACC AGG Intergenic
No off target data available for this crispr