ID: 1084552301

View in Genome Browser
Species Human (GRCh38)
Location 11:69851996-69852018
Sequence TGCCTCTGTGAAGGGTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084552289_1084552301 17 Left 1084552289 11:69851956-69851978 CCTGGAGGACTCCTTCTCAACCT No data
Right 1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG No data
1084552293_1084552301 -3 Left 1084552293 11:69851976-69851998 CCTTCAGGAGCTGGCTCCCTTGC No data
Right 1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG No data
1084552291_1084552301 6 Left 1084552291 11:69851967-69851989 CCTTCTCAACCTTCAGGAGCTGG No data
Right 1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG No data
1084552287_1084552301 29 Left 1084552287 11:69851944-69851966 CCTTCCTTTCTGCCTGGAGGACT No data
Right 1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG No data
1084552288_1084552301 25 Left 1084552288 11:69851948-69851970 CCTTTCTGCCTGGAGGACTCCTT No data
Right 1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084552301 Original CRISPR TGCCTCTGTGAAGGGTCAGG GGG Intergenic