ID: 1084553850

View in Genome Browser
Species Human (GRCh38)
Location 11:69864457-69864479
Sequence GGCTCTCTGCCCATTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084553850_1084553860 13 Left 1084553850 11:69864457-69864479 CCTCTAGGAATGGGCAGAGAGCC No data
Right 1084553860 11:69864493-69864515 TTTGACCTGCAGTGTGACCTCGG No data
1084553850_1084553861 14 Left 1084553850 11:69864457-69864479 CCTCTAGGAATGGGCAGAGAGCC No data
Right 1084553861 11:69864494-69864516 TTGACCTGCAGTGTGACCTCGGG No data
1084553850_1084553863 18 Left 1084553850 11:69864457-69864479 CCTCTAGGAATGGGCAGAGAGCC No data
Right 1084553863 11:69864498-69864520 CCTGCAGTGTGACCTCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084553850 Original CRISPR GGCTCTCTGCCCATTCCTAG AGG (reversed) Intergenic
No off target data available for this crispr