ID: 1084554433

View in Genome Browser
Species Human (GRCh38)
Location 11:69867530-69867552
Sequence ATGGAGCATCAGAATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084554433_1084554441 5 Left 1084554433 11:69867530-69867552 CCTTCCCCATTCTGATGCTCCAT No data
Right 1084554441 11:69867558-69867580 TTTCCATGGCAGGGAAGCAGAGG No data
1084554433_1084554440 -4 Left 1084554433 11:69867530-69867552 CCTTCCCCATTCTGATGCTCCAT No data
Right 1084554440 11:69867549-69867571 CCATCAGCATTTCCATGGCAGGG No data
1084554433_1084554438 -5 Left 1084554433 11:69867530-69867552 CCTTCCCCATTCTGATGCTCCAT No data
Right 1084554438 11:69867548-69867570 TCCATCAGCATTTCCATGGCAGG No data
1084554433_1084554443 13 Left 1084554433 11:69867530-69867552 CCTTCCCCATTCTGATGCTCCAT No data
Right 1084554443 11:69867566-69867588 GCAGGGAAGCAGAGGCTGAGAGG No data
1084554433_1084554437 -9 Left 1084554433 11:69867530-69867552 CCTTCCCCATTCTGATGCTCCAT No data
Right 1084554437 11:69867544-69867566 ATGCTCCATCAGCATTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084554433 Original CRISPR ATGGAGCATCAGAATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr