ID: 1084556710

View in Genome Browser
Species Human (GRCh38)
Location 11:69880060-69880082
Sequence TCCACTCCCCGCTTCTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084556710_1084556713 -1 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556713 11:69880082-69880104 AGAATGCTGGGCCCCTTGCCAGG No data
1084556710_1084556716 5 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556716 11:69880088-69880110 CTGGGCCCCTTGCCAGGGGCAGG No data
1084556710_1084556714 0 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556714 11:69880083-69880105 GAATGCTGGGCCCCTTGCCAGGG No data
1084556710_1084556715 1 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556715 11:69880084-69880106 AATGCTGGGCCCCTTGCCAGGGG No data
1084556710_1084556719 10 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556719 11:69880093-69880115 CCCCTTGCCAGGGGCAGGGATGG No data
1084556710_1084556723 21 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556723 11:69880104-69880126 GGGCAGGGATGGCCCTGCCCAGG No data
1084556710_1084556724 22 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556724 11:69880105-69880127 GGCAGGGATGGCCCTGCCCAGGG No data
1084556710_1084556717 6 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556717 11:69880089-69880111 TGGGCCCCTTGCCAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084556710 Original CRISPR TCCACTCCCCGCTTCTCTTA AGG (reversed) Intergenic
No off target data available for this crispr