ID: 1084556724

View in Genome Browser
Species Human (GRCh38)
Location 11:69880105-69880127
Sequence GGCAGGGATGGCCCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084556710_1084556724 22 Left 1084556710 11:69880060-69880082 CCTTAAGAGAAGCGGGGAGTGGA No data
Right 1084556724 11:69880105-69880127 GGCAGGGATGGCCCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084556724 Original CRISPR GGCAGGGATGGCCCTGCCCA GGG Intergenic
No off target data available for this crispr