ID: 1084561360

View in Genome Browser
Species Human (GRCh38)
Location 11:69907287-69907309
Sequence AGGTGGAAGGGGCAGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084561349_1084561360 21 Left 1084561349 11:69907243-69907265 CCAGAGGGACAGAAGGTGAGGGA No data
Right 1084561360 11:69907287-69907309 AGGTGGAAGGGGCAGGTAACTGG No data
1084561354_1084561360 -8 Left 1084561354 11:69907272-69907294 CCAGGTCCAGAGAGGAGGTGGAA No data
Right 1084561360 11:69907287-69907309 AGGTGGAAGGGGCAGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084561360 Original CRISPR AGGTGGAAGGGGCAGGTAAC TGG Intergenic
No off target data available for this crispr