ID: 1084563767

View in Genome Browser
Species Human (GRCh38)
Location 11:69918467-69918489
Sequence CAGGAAAGGGCCTGGCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563767_1084563785 25 Left 1084563767 11:69918467-69918489 CCCAGACGCCAGGCCCTTTCCTG No data
Right 1084563785 11:69918515-69918537 ACCCCGTGAGGACGTCTGCCCGG No data
1084563767_1084563777 13 Left 1084563767 11:69918467-69918489 CCCAGACGCCAGGCCCTTTCCTG No data
Right 1084563777 11:69918503-69918525 CGCCCCACCCCCACCCCGTGAGG No data
1084563767_1084563787 26 Left 1084563767 11:69918467-69918489 CCCAGACGCCAGGCCCTTTCCTG No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563767 Original CRISPR CAGGAAAGGGCCTGGCGTCT GGG (reversed) Intergenic
No off target data available for this crispr