ID: 1084563771

View in Genome Browser
Species Human (GRCh38)
Location 11:69918475-69918497
Sequence AGGGCACCCAGGAAAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563771_1084563785 17 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563785 11:69918515-69918537 ACCCCGTGAGGACGTCTGCCCGG No data
1084563771_1084563777 5 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563777 11:69918503-69918525 CGCCCCACCCCCACCCCGTGAGG No data
1084563771_1084563790 24 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563771_1084563787 18 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563771 Original CRISPR AGGGCACCCAGGAAAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr