ID: 1084563772

View in Genome Browser
Species Human (GRCh38)
Location 11:69918480-69918502
Sequence TGCTGAGGGCACCCAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563772_1084563785 12 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563785 11:69918515-69918537 ACCCCGTGAGGACGTCTGCCCGG No data
1084563772_1084563777 0 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563777 11:69918503-69918525 CGCCCCACCCCCACCCCGTGAGG No data
1084563772_1084563793 30 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563772_1084563787 13 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563772_1084563790 19 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563772_1084563791 29 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563791 11:69918532-69918554 GCCCGGGCTCCGGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563772 Original CRISPR TGCTGAGGGCACCCAGGAAA GGG (reversed) Intergenic
No off target data available for this crispr