ID: 1084563776

View in Genome Browser
Species Human (GRCh38)
Location 11:69918495-69918517
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563776_1084563798 30 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563776_1084563787 -2 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563776_1084563795 21 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563795 11:69918539-69918561 CTCCGGATGCCCCAGGGCCTTGG No data
1084563776_1084563785 -3 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563785 11:69918515-69918537 ACCCCGTGAGGACGTCTGCCCGG No data
1084563776_1084563790 4 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563776_1084563793 15 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563776_1084563791 14 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563791 11:69918532-69918554 GCCCGGGCTCCGGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563776 Original CRISPR GGTGGGGGTGGGGCGTGCTG AGG (reversed) Intergenic