ID: 1084563778

View in Genome Browser
Species Human (GRCh38)
Location 11:69918505-69918527
Sequence GTCCTCACGGGGTGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563778_1084563800 21 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563800 11:69918549-69918571 CCCAGGGCCTTGGACCACCAGGG No data
1084563778_1084563793 5 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563778_1084563790 -6 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563778_1084563791 4 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563791 11:69918532-69918554 GCCCGGGCTCCGGATGCCCCAGG No data
1084563778_1084563798 20 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563778_1084563795 11 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563795 11:69918539-69918561 CTCCGGATGCCCCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563778 Original CRISPR GTCCTCACGGGGTGGGGGTG GGG (reversed) Intergenic