ID: 1084563781

View in Genome Browser
Species Human (GRCh38)
Location 11:69918510-69918532
Sequence CAGACGTCCTCACGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563781_1084563791 -1 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563791 11:69918532-69918554 GCCCGGGCTCCGGATGCCCCAGG No data
1084563781_1084563803 29 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563803 11:69918562-69918584 ACCACCAGGGACTGTGCCTTAGG No data
1084563781_1084563805 30 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563805 11:69918563-69918585 CCACCAGGGACTGTGCCTTAGGG No data
1084563781_1084563793 0 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563781_1084563798 15 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563781_1084563800 16 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563800 11:69918549-69918571 CCCAGGGCCTTGGACCACCAGGG No data
1084563781_1084563795 6 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563795 11:69918539-69918561 CTCCGGATGCCCCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563781 Original CRISPR CAGACGTCCTCACGGGGTGG GGG (reversed) Intergenic