ID: 1084563784

View in Genome Browser
Species Human (GRCh38)
Location 11:69918513-69918535
Sequence GGGCAGACGTCCTCACGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563784_1084563800 13 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563800 11:69918549-69918571 CCCAGGGCCTTGGACCACCAGGG No data
1084563784_1084563791 -4 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563791 11:69918532-69918554 GCCCGGGCTCCGGATGCCCCAGG No data
1084563784_1084563793 -3 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563784_1084563803 26 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563803 11:69918562-69918584 ACCACCAGGGACTGTGCCTTAGG No data
1084563784_1084563806 28 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563806 11:69918564-69918586 CACCAGGGACTGTGCCTTAGGGG No data
1084563784_1084563805 27 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563805 11:69918563-69918585 CCACCAGGGACTGTGCCTTAGGG No data
1084563784_1084563795 3 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563795 11:69918539-69918561 CTCCGGATGCCCCAGGGCCTTGG No data
1084563784_1084563798 12 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563784 Original CRISPR GGGCAGACGTCCTCACGGGG TGG (reversed) Intergenic