ID: 1084563787

View in Genome Browser
Species Human (GRCh38)
Location 11:69918516-69918538
Sequence CCCCGTGAGGACGTCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563775_1084563787 -1 Left 1084563775 11:69918494-69918516 CCCTCAGCACGCCCCACCCCCAC No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563772_1084563787 13 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563767_1084563787 26 Left 1084563767 11:69918467-69918489 CCCAGACGCCAGGCCCTTTCCTG No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563768_1084563787 25 Left 1084563768 11:69918468-69918490 CCAGACGCCAGGCCCTTTCCTGG No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563774_1084563787 7 Left 1084563774 11:69918486-69918508 CCTGGGTGCCCTCAGCACGCCCC No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563776_1084563787 -2 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563771_1084563787 18 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
1084563773_1084563787 12 Left 1084563773 11:69918481-69918503 CCTTTCCTGGGTGCCCTCAGCAC No data
Right 1084563787 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563787 Original CRISPR CCCCGTGAGGACGTCTGCCC GGG Intergenic
No off target data available for this crispr