ID: 1084563790

View in Genome Browser
Species Human (GRCh38)
Location 11:69918522-69918544
Sequence GAGGACGTCTGCCCGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563772_1084563790 19 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563775_1084563790 5 Left 1084563775 11:69918494-69918516 CCCTCAGCACGCCCCACCCCCAC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563780_1084563790 -8 Left 1084563780 11:69918507-69918529 CCACCCCCACCCCGTGAGGACGT No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563776_1084563790 4 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563779_1084563790 -7 Left 1084563779 11:69918506-69918528 CCCACCCCCACCCCGTGAGGACG No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563771_1084563790 24 Left 1084563771 11:69918475-69918497 CCAGGCCCTTTCCTGGGTGCCCT No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563778_1084563790 -6 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563774_1084563790 13 Left 1084563774 11:69918486-69918508 CCTGGGTGCCCTCAGCACGCCCC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data
1084563773_1084563790 18 Left 1084563773 11:69918481-69918503 CCTTTCCTGGGTGCCCTCAGCAC No data
Right 1084563790 11:69918522-69918544 GAGGACGTCTGCCCGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563790 Original CRISPR GAGGACGTCTGCCCGGGCTC CGG Intergenic