ID: 1084563792

View in Genome Browser
Species Human (GRCh38)
Location 11:69918533-69918555
Sequence CCCTGGGGCATCCGGAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563792_1084563798 -8 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563792_1084563808 12 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563808 11:69918568-69918590 AGGGACTGTGCCTTAGGGGCAGG No data
1084563792_1084563800 -7 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563800 11:69918549-69918571 CCCAGGGCCTTGGACCACCAGGG No data
1084563792_1084563811 24 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563811 11:69918580-69918602 TTAGGGGCAGGGTGACCCTGCGG No data
1084563792_1084563809 13 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563809 11:69918569-69918591 GGGACTGTGCCTTAGGGGCAGGG No data
1084563792_1084563805 7 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563805 11:69918563-69918585 CCACCAGGGACTGTGCCTTAGGG No data
1084563792_1084563812 30 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563812 11:69918586-69918608 GCAGGGTGACCCTGCGGTGCTGG No data
1084563792_1084563806 8 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563806 11:69918564-69918586 CACCAGGGACTGTGCCTTAGGGG No data
1084563792_1084563803 6 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563803 11:69918562-69918584 ACCACCAGGGACTGTGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563792 Original CRISPR CCCTGGGGCATCCGGAGCCC GGG (reversed) Intergenic