ID: 1084563793

View in Genome Browser
Species Human (GRCh38)
Location 11:69918533-69918555
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563783_1084563793 -2 Left 1084563783 11:69918512-69918534 CCCACCCCGTGAGGACGTCTGCC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563772_1084563793 30 Left 1084563772 11:69918480-69918502 CCCTTTCCTGGGTGCCCTCAGCA No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563778_1084563793 5 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563779_1084563793 4 Left 1084563779 11:69918506-69918528 CCCACCCCCACCCCGTGAGGACG No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563784_1084563793 -3 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563780_1084563793 3 Left 1084563780 11:69918507-69918529 CCACCCCCACCCCGTGAGGACGT No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563776_1084563793 15 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563788_1084563793 -7 Left 1084563788 11:69918517-69918539 CCCGTGAGGACGTCTGCCCGGGC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563775_1084563793 16 Left 1084563775 11:69918494-69918516 CCCTCAGCACGCCCCACCCCCAC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563781_1084563793 0 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563786_1084563793 -6 Left 1084563786 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563789_1084563793 -8 Left 1084563789 11:69918518-69918540 CCGTGAGGACGTCTGCCCGGGCT No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563774_1084563793 24 Left 1084563774 11:69918486-69918508 CCTGGGTGCCCTCAGCACGCCCC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563773_1084563793 29 Left 1084563773 11:69918481-69918503 CCTTTCCTGGGTGCCCTCAGCAC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
1084563782_1084563793 -1 Left 1084563782 11:69918511-69918533 CCCCACCCCGTGAGGACGTCTGC No data
Right 1084563793 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563793 Original CRISPR CCCGGGCTCCGGATGCCCCA GGG Intergenic