ID: 1084563798

View in Genome Browser
Species Human (GRCh38)
Location 11:69918548-69918570
Sequence CCCCAGGGCCTTGGACCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084563792_1084563798 -8 Left 1084563792 11:69918533-69918555 CCCGGGCTCCGGATGCCCCAGGG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563786_1084563798 9 Left 1084563786 11:69918516-69918538 CCCCGTGAGGACGTCTGCCCGGG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563788_1084563798 8 Left 1084563788 11:69918517-69918539 CCCGTGAGGACGTCTGCCCGGGC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563789_1084563798 7 Left 1084563789 11:69918518-69918540 CCGTGAGGACGTCTGCCCGGGCT No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563783_1084563798 13 Left 1084563783 11:69918512-69918534 CCCACCCCGTGAGGACGTCTGCC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563784_1084563798 12 Left 1084563784 11:69918513-69918535 CCACCCCGTGAGGACGTCTGCCC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563794_1084563798 -9 Left 1084563794 11:69918534-69918556 CCGGGCTCCGGATGCCCCAGGGC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563779_1084563798 19 Left 1084563779 11:69918506-69918528 CCCACCCCCACCCCGTGAGGACG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563780_1084563798 18 Left 1084563780 11:69918507-69918529 CCACCCCCACCCCGTGAGGACGT No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563782_1084563798 14 Left 1084563782 11:69918511-69918533 CCCCACCCCGTGAGGACGTCTGC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563778_1084563798 20 Left 1084563778 11:69918505-69918527 CCCCACCCCCACCCCGTGAGGAC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563776_1084563798 30 Left 1084563776 11:69918495-69918517 CCTCAGCACGCCCCACCCCCACC No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data
1084563781_1084563798 15 Left 1084563781 11:69918510-69918532 CCCCCACCCCGTGAGGACGTCTG No data
Right 1084563798 11:69918548-69918570 CCCCAGGGCCTTGGACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084563798 Original CRISPR CCCCAGGGCCTTGGACCACC AGG Intergenic