ID: 1084564097

View in Genome Browser
Species Human (GRCh38)
Location 11:69919897-69919919
Sequence GAAGGAGGACTCACCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084564097_1084564104 3 Left 1084564097 11:69919897-69919919 CCTCCTGGGGTGAGTCCTCCTTC No data
Right 1084564104 11:69919923-69919945 AGGTAAGTCCTCCCTTCTCAGGG No data
1084564097_1084564103 2 Left 1084564097 11:69919897-69919919 CCTCCTGGGGTGAGTCCTCCTTC No data
Right 1084564103 11:69919922-69919944 GAGGTAAGTCCTCCCTTCTCAGG No data
1084564097_1084564109 23 Left 1084564097 11:69919897-69919919 CCTCCTGGGGTGAGTCCTCCTTC No data
Right 1084564109 11:69919943-69919965 GGGTGAGTCCTCTCTCCTCAGGG No data
1084564097_1084564108 22 Left 1084564097 11:69919897-69919919 CCTCCTGGGGTGAGTCCTCCTTC No data
Right 1084564108 11:69919942-69919964 AGGGTGAGTCCTCTCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084564097 Original CRISPR GAAGGAGGACTCACCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr