ID: 1084564277

View in Genome Browser
Species Human (GRCh38)
Location 11:69920525-69920547
Sequence GAGGGAGGACTCACCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084564277_1084564288 12 Left 1084564277 11:69920525-69920547 CCTCCTGGGGTGAGTCCTCCCTC No data
Right 1084564288 11:69920560-69920582 TCTCCCCAGCCGGCTTCCATGGG No data
1084564277_1084564287 11 Left 1084564277 11:69920525-69920547 CCTCCTGGGGTGAGTCCTCCCTC No data
Right 1084564287 11:69920559-69920581 CTCTCCCCAGCCGGCTTCCATGG No data
1084564277_1084564289 13 Left 1084564277 11:69920525-69920547 CCTCCTGGGGTGAGTCCTCCCTC No data
Right 1084564289 11:69920561-69920583 CTCCCCAGCCGGCTTCCATGGGG No data
1084564277_1084564294 25 Left 1084564277 11:69920525-69920547 CCTCCTGGGGTGAGTCCTCCCTC No data
Right 1084564294 11:69920573-69920595 CTTCCATGGGGCTTCTTCAGTGG No data
1084564277_1084564283 2 Left 1084564277 11:69920525-69920547 CCTCCTGGGGTGAGTCCTCCCTC No data
Right 1084564283 11:69920550-69920572 GTCCACCTCCTCTCCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084564277 Original CRISPR GAGGGAGGACTCACCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr