ID: 1084567461

View in Genome Browser
Species Human (GRCh38)
Location 11:69939571-69939593
Sequence GCTTTGAGGTTCCGCCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084567461_1084567465 -4 Left 1084567461 11:69939571-69939593 CCGCGGAGGCGGAACCTCAAAGC No data
Right 1084567465 11:69939590-69939612 AAGCCGTGTTCATGGACTCAGGG No data
1084567461_1084567464 -5 Left 1084567461 11:69939571-69939593 CCGCGGAGGCGGAACCTCAAAGC No data
Right 1084567464 11:69939589-69939611 AAAGCCGTGTTCATGGACTCAGG No data
1084567461_1084567467 6 Left 1084567461 11:69939571-69939593 CCGCGGAGGCGGAACCTCAAAGC No data
Right 1084567467 11:69939600-69939622 CATGGACTCAGGGAATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084567461 Original CRISPR GCTTTGAGGTTCCGCCTCCG CGG (reversed) Intergenic
No off target data available for this crispr