ID: 1084570149

View in Genome Browser
Species Human (GRCh38)
Location 11:69954685-69954707
Sequence TTTAGATTCTGCAAGAGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084570145_1084570149 -5 Left 1084570145 11:69954667-69954689 CCCGGCCTACCTGTGTATTTTAG No data
Right 1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG No data
1084570142_1084570149 30 Left 1084570142 11:69954632-69954654 CCAAAGTACTGGGATTTCAGGTG 0: 19
1: 2745
2: 80966
3: 218845
4: 258197
Right 1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG No data
1084570147_1084570149 -10 Left 1084570147 11:69954672-69954694 CCTACCTGTGTATTTTAGATTCT No data
Right 1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG No data
1084570146_1084570149 -6 Left 1084570146 11:69954668-69954690 CCGGCCTACCTGTGTATTTTAGA No data
Right 1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG No data
1084570144_1084570149 3 Left 1084570144 11:69954659-69954681 CCACTATGCCCGGCCTACCTGTG No data
Right 1084570149 11:69954685-69954707 TTTAGATTCTGCAAGAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084570149 Original CRISPR TTTAGATTCTGCAAGAGTAG TGG Intergenic
No off target data available for this crispr