ID: 1084575585

View in Genome Browser
Species Human (GRCh38)
Location 11:69986145-69986167
Sequence CCCAGGGAAGTCCCCACAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084575573_1084575585 15 Left 1084575573 11:69986107-69986129 CCATGCAGGAGGGCGACATCGGC 0: 1
1: 0
2: 1
3: 6
4: 70
Right 1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG 0: 1
1: 0
2: 3
3: 16
4: 177
1084575579_1084575585 -7 Left 1084575579 11:69986129-69986151 CCTGGAGGGGCTGCCCCCCAGGG 0: 1
1: 0
2: 3
3: 47
4: 437
Right 1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG 0: 1
1: 0
2: 3
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084575585 Original CRISPR CCCAGGGAAGTCCCCACAGT CGG Intergenic
900476788 1:2879805-2879827 CCCAGGGATCTTCCCACAGGTGG - Intergenic
901523547 1:9804445-9804467 CCCAGGGAGGCCCTCACAGGTGG - Intronic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
902638518 1:17751026-17751048 CCCAGGGTAGGACCCACAGTGGG + Intergenic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
903642657 1:24870678-24870700 CCCATGGAAGTCCCCAAAGTAGG + Intergenic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
905386112 1:37605492-37605514 CCCAGGGCAGTGCTCACATTGGG + Intergenic
905522016 1:38607772-38607794 CCCAGGGAAGGCCCCCCATCAGG + Intergenic
906545111 1:46615016-46615038 CCCAAAGAAGTCCCCAGGGTGGG + Exonic
909520958 1:76566956-76566978 CCCAGTGAATTCCAAACAGTTGG + Intronic
911572813 1:99538362-99538384 CCCAGGTCAGTCCTCACAGTTGG + Intergenic
912136235 1:106662927-106662949 CCCAGGAAAGTAGCCTCAGTAGG + Intergenic
912453981 1:109785699-109785721 ACCAGTGCAGTCCCCACAGTGGG + Intergenic
913495707 1:119426397-119426419 CACAGGGGACTCCCCACAGTGGG + Intergenic
915080161 1:153346390-153346412 CCCAGGGGATTTCCCAGAGTTGG - Intronic
915142827 1:153777638-153777660 CCCTGGGAAGGGCCCACTGTGGG - Intronic
917084435 1:171291820-171291842 CACAGGGGACTCCCCACAGTGGG + Intergenic
919729851 1:200906666-200906688 CCCAGGGAAGTTTCTTCAGTTGG - Intronic
920281886 1:204849718-204849740 CCCCTGGAAGTGCCCGCAGTTGG + Intronic
920403822 1:205694082-205694104 CAGAGGGAAGCCCCCACAGAGGG - Intergenic
920457747 1:206113934-206113956 AGCAGGGAGGTCCCTACAGTTGG + Intronic
922730430 1:227946520-227946542 CCCAGGGCCGTACCCACAGTTGG + Intronic
923520221 1:234729572-234729594 CTCAGGGAAGTCCTCGCAGCGGG + Intergenic
1063720621 10:8577268-8577290 CTCAGGAAAGTCCCCAAAGAAGG - Intergenic
1066154781 10:32662965-32662987 GGCAGGGAACTCACCACAGTTGG + Intronic
1067183278 10:44006266-44006288 CCCAGGGAAGTGCCCCCAGGGGG - Intergenic
1067222690 10:44355482-44355504 CCCACGGAAGCCCCTGCAGTTGG + Intergenic
1070023027 10:72605560-72605582 CACAGGGCAAACCCCACAGTTGG - Intronic
1070718612 10:78740568-78740590 CTCAGAGAAGACCCCACAGCTGG + Intergenic
1072513077 10:96148647-96148669 CCCAAAGAGCTCCCCACAGTGGG - Intronic
1075903542 10:126062371-126062393 CCCAGGGAAGCCCCCTCCTTAGG + Intronic
1076728180 10:132423073-132423095 AACAGGGAAGTCCCCAGAGACGG - Intergenic
1076898891 10:133327356-133327378 CCCAGGTGACTGCCCACAGTGGG + Intronic
1077506357 11:2931590-2931612 CCCAGAGAACTCCCCAAAGTGGG + Intergenic
1078581467 11:12542499-12542521 CCCAGGGATGTCCCCAAAGGTGG + Intergenic
1078633928 11:13031189-13031211 ACCAGGGAAGCTCCCACACTAGG - Intergenic
1078669692 11:13353928-13353950 CCCAGGGCAGTTCCCACGGAGGG - Intronic
1083944332 11:65915731-65915753 CCTTGGGAAGTCCCCAGAGCTGG - Intergenic
1084084650 11:66849436-66849458 CCATAGGAAGTCCCCACACTGGG + Intronic
1084575585 11:69986145-69986167 CCCAGGGAAGTCCCCACAGTCGG + Intergenic
1084686352 11:70698069-70698091 CCCAAGGACTTCCCCACAGCTGG + Intronic
1085329072 11:75632276-75632298 CCTGGGCAAGTCCCCAGAGTTGG - Intronic
1085455573 11:76663602-76663624 CCCAGGGATGCCCCGTCAGTTGG + Intronic
1086766182 11:90698352-90698374 ACCAGGGAAGGCCACACAGGAGG + Intergenic
1091220513 11:133927612-133927634 ACCAGGGGTTTCCCCACAGTGGG + Intronic
1091224043 11:133947028-133947050 CCCAGGGCTGTCCCCACGTTGGG + Intronic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1100849687 12:98696381-98696403 CCCAGGGAACTCACCCCAGTGGG + Intronic
1102422293 12:112813534-112813556 CCCAGGGAAGTGAACACAGCTGG + Intronic
1107814469 13:44232017-44232039 CCCAGGGTGGTAGCCACAGTCGG - Intergenic
1110186636 13:72682955-72682977 CCCAGGGGAGACCCCACTGTTGG + Intergenic
1112389005 13:98965531-98965553 CCCAGGGCAGTCCCTAGGGTTGG - Intronic
1112567736 13:100565753-100565775 CACACAGAAGTCCCCACAGCTGG - Intronic
1113442198 13:110337737-110337759 CCCAGGGAAGTCCCTGCAGCAGG + Intronic
1114389711 14:22293899-22293921 CCCATGGAAGTCTCCAGAGCAGG - Intergenic
1117487307 14:56211373-56211395 CCCAGGGAAGGCTTCACAGAAGG - Intronic
1118033177 14:61838318-61838340 CCCAGTCCACTCCCCACAGTTGG + Intergenic
1118347665 14:64951585-64951607 CCCAGGTAAGCCACCACATTGGG - Exonic
1119400388 14:74358627-74358649 CCCAGGGCCAGCCCCACAGTGGG + Exonic
1119512133 14:75220035-75220057 GCCAGGGAAGTTCCCAGAGATGG + Intergenic
1119850943 14:77866484-77866506 CCCAGGTAACCCCCCAAAGTGGG - Intronic
1120349997 14:83342862-83342884 CCCAGAACAGGCCCCACAGTGGG + Intergenic
1120384094 14:83821884-83821906 CCCAAGAGAGTTCCCACAGTTGG + Intergenic
1121308954 14:92924421-92924443 GCTGGGGAAGTCCCCACAGCAGG - Intronic
1121606107 14:95241242-95241264 CCCAGGCAAATCCGGACAGTTGG - Intronic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1122378673 14:101286287-101286309 CCCAGGGATGCCCACACAGGAGG - Intergenic
1122870328 14:104635420-104635442 CCCAGGGAAGTCCCCGCCCTGGG + Intergenic
1125971725 15:43917267-43917289 GCCAGGGCAGACCCCAAAGTTGG - Intronic
1128354022 15:66911719-66911741 GCCAGAGAAGTCCCCAGAGCTGG + Intergenic
1129171299 15:73809805-73809827 CCCAGGGAAGACCCCATGGGAGG + Intergenic
1129457419 15:75683222-75683244 CCCAGGGAAGGCCCCAGGGAAGG + Intronic
1129726372 15:77903723-77903745 CCCAGGGAAGGCCCCAGGGAAGG - Intergenic
1132245449 15:100292933-100292955 ACCAAGGAAGACCCCACAGAGGG + Intronic
1132282388 15:100631446-100631468 CACACAGAAGTCGCCACAGTTGG + Intronic
1132615847 16:840787-840809 CCCCCAGAAGCCCCCACAGTGGG - Intergenic
1136189387 16:28606654-28606676 CCCTGGGCAGCCCCCACAGCAGG - Intronic
1139337931 16:66246058-66246080 CCCAGGGAATTCCCCATCTTTGG - Intergenic
1141720418 16:85752380-85752402 CCCAGGGATGTGCCCTCAGCAGG - Intergenic
1142126388 16:88412654-88412676 CACAGCGATGTCCCCACACTCGG + Intergenic
1143186617 17:5014030-5014052 CCCAGGGAAGGCCCCACCAAGGG - Intronic
1144628649 17:16858404-16858426 CCCAGGGAAGGCCGTGCAGTTGG - Intergenic
1144652754 17:17017696-17017718 CCCAGGGAAGGCCGTGCAGTTGG + Intergenic
1145160238 17:20568975-20568997 CCCAGGGAAGGCCGTGCAGTTGG - Intergenic
1151295157 17:73179883-73179905 CCCAGGGAAGTCTCCACTCCAGG + Intergenic
1152262066 17:79272640-79272662 AACAGGGAAGTCCCCAAAGGGGG - Intronic
1152614237 17:81330572-81330594 CCCACGGCAGCCCCCACTGTTGG - Exonic
1152644645 17:81463156-81463178 CCCAGGTCCCTCCCCACAGTGGG + Intronic
1152694190 17:81735445-81735467 CACAGGGAACTCCCCCCAGGAGG - Intergenic
1156349592 18:36292115-36292137 CACTGGGAATTCCCCACACTGGG + Intergenic
1156479900 18:37429837-37429859 CCTACGGAAGACCCCACACTTGG + Intronic
1158859826 18:61581529-61581551 CACTGGGAAGTCGTCACAGTGGG + Intergenic
1161258589 19:3323235-3323257 CCCTGGGAAGCCCCCACATCAGG + Intergenic
1161324507 19:3656946-3656968 CTCAGGGAAGGCTCCACAGATGG + Intronic
1163104258 19:15114537-15114559 TCCGGGGAAGTCCCCACGATTGG + Exonic
1163212924 19:15854759-15854781 GCCAAGGAAGTGCCCACAGGTGG - Intergenic
1165827651 19:38714358-38714380 CCCACGGAACTCCTCACAGAGGG - Intronic
925098561 2:1227295-1227317 CCCTGGAAAGTGCACACAGTAGG - Intronic
925152836 2:1627406-1627428 CCCTCTGGAGTCCCCACAGTTGG + Intergenic
928135154 2:28682462-28682484 AACATGGAAGTCCCCACAATGGG - Intergenic
928327823 2:30334026-30334048 CCCAGGCAGGCACCCACAGTTGG + Intergenic
932323284 2:70837630-70837652 CCCAGAGAGGACCCCACACTGGG + Intergenic
932892616 2:75609961-75609983 CCCAAGGAAGCCCCCTCACTAGG - Intergenic
934162674 2:89267333-89267355 CTCAGGGCAGGCCCCACACTGGG - Intergenic
934204600 2:89915191-89915213 CTCAGGGCAGGCCCCACACTGGG + Intergenic
936055032 2:109256208-109256230 GACAAGGAAGACCCCACAGTTGG + Intronic
936452281 2:112642734-112642756 CCCATGCAAGTCCTCACAGACGG + Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
938203989 2:129401598-129401620 TGAAGGGAAGTCCCCCCAGTGGG + Intergenic
942742471 2:179196057-179196079 ACCAGGGAAGGCCAGACAGTGGG + Intronic
943720041 2:191194333-191194355 CACAGGAAAGTCCCTTCAGTGGG + Intergenic
944904883 2:204252463-204252485 CTAAGGGAAGCCCCCACAGCAGG + Intergenic
948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG + Intronic
948615115 2:239193502-239193524 CCAGGGGAAGGGCCCACAGTGGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1170667084 20:18395549-18395571 CCCAGCAAAGTGCCCTCAGTAGG + Intronic
1171796154 20:29568012-29568034 CCCTGGGGAGTCCTCAGAGTGGG - Intergenic
1171798061 20:29581834-29581856 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1172802020 20:37582389-37582411 CCCAGTGCAGTCCCCTCAGCTGG - Intergenic
1175069643 20:56322401-56322423 CACAGGACAGTCCCCACTGTAGG - Intergenic
1175413307 20:58785477-58785499 TCCAGGGAAATGCCCACACTGGG - Intergenic
1175587078 20:60149616-60149638 CCAAAGGCAGCCCCCACAGTGGG + Intergenic
1176385106 21:6135194-6135216 CCCAAGGAAGCACCCACAGCAGG + Intergenic
1179738367 21:43403058-43403080 CCCAAGGAAGCACCCACAGCAGG - Intergenic
1180077372 21:45469525-45469547 CTCCGGGAAGTCCCTCCAGTGGG + Intronic
1184789361 22:46689897-46689919 CCCAGGGAACCCCCCACCCTGGG + Intronic
954420826 3:50418208-50418230 ACCAGGGAAGGACACACAGTAGG + Intronic
955089651 3:55737008-55737030 CCCAAGGAAGCCTCCACATTGGG + Intronic
955567527 3:60264078-60264100 TCCAGTGAATTCCCCAAAGTGGG + Intronic
961774212 3:129272394-129272416 CCCAAAGAAGACCCCACAGCTGG + Exonic
962748204 3:138413233-138413255 CCCAGGGGAGCACCCACAGCTGG + Intergenic
963027053 3:140930432-140930454 CTCAGGGGAATCCCAACAGTTGG - Intergenic
964242811 3:154616306-154616328 CTCAGGGATGTGCCCACTGTAGG - Intergenic
965556929 3:170028051-170028073 TCCAGTGAAGGCCCCACTGTTGG - Intergenic
969688063 4:8688012-8688034 CCCAGGAAAGACAGCACAGTGGG - Intergenic
976482186 4:85557512-85557534 GCCAGGGGAGTCACCACACTGGG - Intronic
977802913 4:101259451-101259473 CACAGACCAGTCCCCACAGTGGG + Intronic
979231943 4:118356070-118356092 CCCAGGGAGGCCCCCATAATGGG + Intergenic
984890243 4:184485609-184485631 GCCAGGGCAGTCTTCACAGTTGG + Intergenic
985610372 5:884669-884691 CCCAGGCAAGTGCCCAGGGTGGG - Intronic
986446476 5:7825666-7825688 GCCAGGGAAGACCCCTCTGTTGG - Intronic
986875913 5:12109150-12109172 CCCAGGTCAGTCCTCACATTTGG - Intergenic
989606248 5:43246815-43246837 CTTGGGGAAGTGCCCACAGTGGG - Intronic
992772365 5:80060380-80060402 CCCAGGGAGGGCCCCAGAGGAGG + Intronic
998669298 5:144335637-144335659 TCCAGGGAAGGCTCCACAGGAGG + Intronic
1001664507 5:173421379-173421401 CCCAGAGAGGCCCACACAGTGGG - Intergenic
1002329961 5:178434541-178434563 CCCAGGGAAGGCCCCAGGCTGGG - Intronic
1004549215 6:16630155-16630177 CCCAAGGGAATGCCCACAGTTGG - Intronic
1006798083 6:36743600-36743622 ACCAGGGAAGCCCCCAAAGGGGG + Intronic
1007385703 6:41518929-41518951 TCCAGCTCAGTCCCCACAGTTGG + Intergenic
1013415850 6:109923952-109923974 CCAAGTGAAGTCACCACACTTGG - Intergenic
1013459123 6:110358344-110358366 CGCGGGGGAGTTCCCACAGTTGG - Intergenic
1013732488 6:113184967-113184989 TCCAGGGAAGAGACCACAGTGGG + Intergenic
1018936135 6:168275148-168275170 CTTAGGGACCTCCCCACAGTGGG + Intergenic
1019257366 7:60891-60913 CCCAGGGCAGGGCCCACGGTGGG + Intergenic
1019605992 7:1910507-1910529 CCCAGGGCAGTGCCCAGCGTGGG - Intronic
1026901395 7:74039415-74039437 CCCAGGGAGGCCCCCACATCCGG + Intronic
1029835166 7:103301670-103301692 CCCAAGTAAATCCCCAAAGTTGG - Intronic
1032388443 7:131540385-131540407 CCCAGGGAAGGCCCCACCCCAGG + Intronic
1032499164 7:132386782-132386804 CCCAGGGTTGTCCCCAAAGACGG + Intronic
1032957441 7:136987348-136987370 CCAAGGGCAGTCCCCACATGTGG - Intronic
1034969277 7:155409071-155409093 CCCAAGGAATTCCCCGCCGTAGG - Intergenic
1035053997 7:156021695-156021717 CCCAGGGAAGGCCCCATGGGAGG - Intergenic
1037758016 8:21723890-21723912 CCAAGGGGAGTCCCCACAGCAGG + Intronic
1039883939 8:41645091-41645113 CTCGGGGAAGGCCCCACAGCTGG + Intergenic
1040983901 8:53272328-53272350 CCCAGGGAAGTGGCCAGAGATGG - Intergenic
1047451678 8:124970640-124970662 ATCAGGGAAGTCCTCTCAGTAGG - Intergenic
1048980002 8:139698104-139698126 CCCAGGGAAAACACCACAGTTGG + Intronic
1049394837 8:142395159-142395181 CACAGGAAAATGCCCACAGTGGG - Intronic
1052338260 9:27340838-27340860 CCCATGGAGGTCTGCACAGTTGG + Intronic
1052851597 9:33381578-33381600 ACCAGGGAAGGGCCCACAGCTGG - Intergenic
1053002708 9:34586066-34586088 CCCATGGGAGCCCACACAGTAGG - Intronic
1053148615 9:35728785-35728807 CCCAGGGTCTTCCCCACAGCTGG - Intronic
1053787955 9:41665620-41665642 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054157176 9:61649148-61649170 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054176231 9:61876962-61876984 CCCAGGGAAAGGCCCACAGAGGG + Intergenic
1054476951 9:65580153-65580175 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1054661308 9:67703846-67703868 CCCAGGGAAAGGCCCACAGAGGG - Intergenic
1055645428 9:78357640-78357662 CCCAGGGAAGTCCCACCTTTAGG + Intergenic
1056035526 9:82600896-82600918 CCCAGAGAGGCCTCCACAGTTGG + Intergenic
1056468846 9:86885575-86885597 CCCAGGGTTGTCTTCACAGTCGG + Intergenic
1057560599 9:96125279-96125301 CCAAGGGCAGTCTCCCCAGTTGG - Intergenic
1058220226 9:102290537-102290559 CCCAGGAAAGCTGCCACAGTGGG + Intergenic
1058687539 9:107491171-107491193 CCCAGGGAAGTCCCTTTAGGGGG - Intergenic
1185645501 X:1612807-1612829 CCCTGAGAAATCCCCACAGCAGG + Intergenic
1186292748 X:8118452-8118474 CCCAAGAAAGTCAGCACAGTGGG + Intergenic
1186836142 X:13440285-13440307 ACCAGGGAATTCCCAGCAGTGGG + Intergenic
1187366483 X:18669795-18669817 CCCAGGGTAGGGCACACAGTAGG + Intronic
1190249117 X:48708778-48708800 CCTAGAGAAGTCCTCACAGGGGG - Exonic
1193075930 X:77355623-77355645 CCCAGGAAAGACTCCAGAGTTGG + Intergenic
1193640780 X:84007734-84007756 CACAGGGGACTCCCGACAGTGGG - Intergenic
1194738158 X:97539299-97539321 CCCAGAGAGGTCTCCACAGAAGG + Intronic
1195017902 X:100796780-100796802 CACAGGGGACTCCCCACAGTGGG - Intergenic
1199621782 X:149707772-149707794 CCCAGGTCAGTCCTCACATTTGG + Intronic
1201491819 Y:14549905-14549927 CCCAGGGAAGTCTCCACTGTTGG - Intronic