ID: 1084575921

View in Genome Browser
Species Human (GRCh38)
Location 11:69987883-69987905
Sequence CTGTAATCATGGATGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084575916_1084575921 21 Left 1084575916 11:69987839-69987861 CCTGGAGTGTTCCTTACTGGAGG No data
Right 1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG No data
1084575918_1084575921 10 Left 1084575918 11:69987850-69987872 CCTTACTGGAGGATTCAGCTCAT No data
Right 1084575921 11:69987883-69987905 CTGTAATCATGGATGGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084575921 Original CRISPR CTGTAATCATGGATGGATGA CGG Intergenic
No off target data available for this crispr