ID: 1084578388

View in Genome Browser
Species Human (GRCh38)
Location 11:70006103-70006125
Sequence GGGTAGGTGTGTTTAGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084578388_1084578395 8 Left 1084578388 11:70006103-70006125 CCGGTCCCTAAACACACCTACCC No data
Right 1084578395 11:70006134-70006156 TATGTGCCATCTCAGGAGTGAGG No data
1084578388_1084578394 1 Left 1084578388 11:70006103-70006125 CCGGTCCCTAAACACACCTACCC No data
Right 1084578394 11:70006127-70006149 GCTGTCTTATGTGCCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084578388 Original CRISPR GGGTAGGTGTGTTTAGGGAC CGG (reversed) Intergenic