ID: 1084579867

View in Genome Browser
Species Human (GRCh38)
Location 11:70016508-70016530
Sequence TGATTGTGGTCACAGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084579860_1084579867 4 Left 1084579860 11:70016481-70016503 CCATTCCTCAGCCCCTCTGGGGT No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data
1084579862_1084579867 -7 Left 1084579862 11:70016492-70016514 CCCCTCTGGGGTCATGTGATTGT No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data
1084579856_1084579867 11 Left 1084579856 11:70016474-70016496 CCAAGCACCATTCCTCAGCCCCT No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data
1084579863_1084579867 -8 Left 1084579863 11:70016493-70016515 CCCTCTGGGGTCATGTGATTGTG No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data
1084579864_1084579867 -9 Left 1084579864 11:70016494-70016516 CCTCTGGGGTCATGTGATTGTGG No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data
1084579861_1084579867 -1 Left 1084579861 11:70016486-70016508 CCTCAGCCCCTCTGGGGTCATGT No data
Right 1084579867 11:70016508-70016530 TGATTGTGGTCACAGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084579867 Original CRISPR TGATTGTGGTCACAGGACAG TGG Intergenic