ID: 1084580518

View in Genome Browser
Species Human (GRCh38)
Location 11:70020272-70020294
Sequence GTGGGGGATTTCCTGTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084580518_1084580537 29 Left 1084580518 11:70020272-70020294 CCTATCCACAGGAAATCCCCCAC No data
Right 1084580537 11:70020324-70020346 CATCATCTCTGCTGGTGGTGGGG No data
1084580518_1084580532 24 Left 1084580518 11:70020272-70020294 CCTATCCACAGGAAATCCCCCAC No data
Right 1084580532 11:70020319-70020341 ACCCTCATCATCTCTGCTGGTGG No data
1084580518_1084580536 28 Left 1084580518 11:70020272-70020294 CCTATCCACAGGAAATCCCCCAC No data
Right 1084580536 11:70020323-70020345 TCATCATCTCTGCTGGTGGTGGG No data
1084580518_1084580530 21 Left 1084580518 11:70020272-70020294 CCTATCCACAGGAAATCCCCCAC No data
Right 1084580530 11:70020316-70020338 CCCACCCTCATCATCTCTGCTGG No data
1084580518_1084580535 27 Left 1084580518 11:70020272-70020294 CCTATCCACAGGAAATCCCCCAC No data
Right 1084580535 11:70020322-70020344 CTCATCATCTCTGCTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084580518 Original CRISPR GTGGGGGATTTCCTGTGGAT AGG (reversed) Intergenic
No off target data available for this crispr