ID: 1084581645 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:70027825-70027847 |
Sequence | AGCTTAACCACGTCCAGTGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1084581645_1084581650 | 15 | Left | 1084581645 | 11:70027825-70027847 | CCTGCACTGGACGTGGTTAAGCT | No data | ||
Right | 1084581650 | 11:70027863-70027885 | CATCCTTAGAGCACAGCTTTAGG | No data | ||||
1084581645_1084581647 | -10 | Left | 1084581645 | 11:70027825-70027847 | CCTGCACTGGACGTGGTTAAGCT | No data | ||
Right | 1084581647 | 11:70027838-70027860 | TGGTTAAGCTGCCACCACGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1084581645 | Original CRISPR | AGCTTAACCACGTCCAGTGC AGG (reversed) | Intergenic | ||