ID: 1084581648

View in Genome Browser
Species Human (GRCh38)
Location 11:70027849-70027871
Sequence CTAAGGATGCGCCTCCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084581648_1084581650 -9 Left 1084581648 11:70027849-70027871 CCACCACGGAGGCGCATCCTTAG No data
Right 1084581650 11:70027863-70027885 CATCCTTAGAGCACAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084581648 Original CRISPR CTAAGGATGCGCCTCCGTGG TGG (reversed) Intergenic
No off target data available for this crispr