ID: 1084582468

View in Genome Browser
Species Human (GRCh38)
Location 11:70032510-70032532
Sequence GAGAGTGAGCAGAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084582456_1084582468 24 Left 1084582456 11:70032463-70032485 CCCTGGGTGGGGAGAGGAGATTA No data
Right 1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG No data
1084582457_1084582468 23 Left 1084582457 11:70032464-70032486 CCTGGGTGGGGAGAGGAGATTAG No data
Right 1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084582468 Original CRISPR GAGAGTGAGCAGAGGGAGGC GGG Intergenic
No off target data available for this crispr