ID: 1084583039

View in Genome Browser
Species Human (GRCh38)
Location 11:70036331-70036353
Sequence CCCTGGATTTGGGGGTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084583028_1084583039 27 Left 1084583028 11:70036281-70036303 CCTTTTCCTCTTCTACCTGTGTC No data
Right 1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG No data
1084583031_1084583039 1 Left 1084583031 11:70036307-70036329 CCTCTGTGTGTCCTTTACAGTTG No data
Right 1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG No data
1084583033_1084583039 -10 Left 1084583033 11:70036318-70036340 CCTTTACAGTTGTCCCTGGATTT No data
Right 1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG No data
1084583030_1084583039 12 Left 1084583030 11:70036296-70036318 CCTGTGTCTCTCCTCTGTGTGTC No data
Right 1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG No data
1084583029_1084583039 21 Left 1084583029 11:70036287-70036309 CCTCTTCTACCTGTGTCTCTCCT No data
Right 1084583039 11:70036331-70036353 CCCTGGATTTGGGGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084583039 Original CRISPR CCCTGGATTTGGGGGTCACT TGG Intergenic