ID: 1084587707

View in Genome Browser
Species Human (GRCh38)
Location 11:70072733-70072755
Sequence CACGCCCGGCGTACACCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084587704_1084587707 6 Left 1084587704 11:70072704-70072726 CCAGGGGAGGGATGCAACTTTGG No data
Right 1084587707 11:70072733-70072755 CACGCCCGGCGTACACCCCGTGG No data
1084587700_1084587707 19 Left 1084587700 11:70072691-70072713 CCGGTCACCAACACCAGGGGAGG No data
Right 1084587707 11:70072733-70072755 CACGCCCGGCGTACACCCCGTGG No data
1084587703_1084587707 12 Left 1084587703 11:70072698-70072720 CCAACACCAGGGGAGGGATGCAA No data
Right 1084587707 11:70072733-70072755 CACGCCCGGCGTACACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084587707 Original CRISPR CACGCCCGGCGTACACCCCG TGG Intergenic
No off target data available for this crispr