ID: 1084588819

View in Genome Browser
Species Human (GRCh38)
Location 11:70078704-70078726
Sequence GCCCGCACTCACCGTGCCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084588819_1084588835 28 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588835 11:70078755-70078777 ACCTGCGCCTTGGCGAGGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1084588819_1084588824 -5 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588824 11:70078722-70078744 CGGGCGGCCGCGACCCGGGCGGG 0: 1
1: 0
2: 5
3: 45
4: 315
1084588819_1084588822 -9 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588822 11:70078718-70078740 AGTGCGGGCGGCCGCGACCCGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1084588819_1084588834 27 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588834 11:70078754-70078776 CACCTGCGCCTTGGCGAGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 156
1084588819_1084588832 23 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588832 11:70078750-70078772 CGCGCACCTGCGCCTTGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1084588819_1084588821 -10 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588821 11:70078717-70078739 GAGTGCGGGCGGCCGCGACCCGG 0: 1
1: 0
2: 1
3: 11
4: 152
1084588819_1084588826 -1 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588826 11:70078726-70078748 CGGCCGCGACCCGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 519
1084588819_1084588833 24 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588819_1084588825 -2 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588825 11:70078725-70078747 GCGGCCGCGACCCGGGCGGGAGG 0: 1
1: 1
2: 9
3: 84
4: 433
1084588819_1084588830 18 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588830 11:70078745-70078767 AGGGCCGCGCACCTGCGCCTTGG 0: 1
1: 0
2: 1
3: 14
4: 129
1084588819_1084588823 -6 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588823 11:70078721-70078743 GCGGGCGGCCGCGACCCGGGCGG 0: 1
1: 0
2: 6
3: 35
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084588819 Original CRISPR GCCCGCACTCACCGTGCCCT CGG (reversed) Exonic