ID: 1084588828

View in Genome Browser
Species Human (GRCh38)
Location 11:70078735-70078757
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 191}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084588828_1084588833 -7 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588828_1084588842 14 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588842 11:70078772-70078794 GGCGGGAACCGGGCGGCGGCAGG 0: 1
1: 1
2: 4
3: 58
4: 519
1084588828_1084588837 3 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588837 11:70078761-70078783 GCCTTGGCGAGGGCGGGAACCGG 0: 1
1: 0
2: 1
3: 11
4: 150
1084588828_1084588832 -8 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588832 11:70078750-70078772 CGCGCACCTGCGCCTTGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1084588828_1084588839 4 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588839 11:70078762-70078784 CCTTGGCGAGGGCGGGAACCGGG 0: 1
1: 0
2: 1
3: 10
4: 166
1084588828_1084588840 7 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588840 11:70078765-70078787 TGGCGAGGGCGGGAACCGGGCGG 0: 1
1: 0
2: 2
3: 23
4: 244
1084588828_1084588843 15 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588843 11:70078773-70078795 GCGGGAACCGGGCGGCGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 185
1084588828_1084588846 24 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588846 11:70078782-70078804 GGGCGGCGGCAGGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 53
4: 429
1084588828_1084588841 10 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588841 11:70078768-70078790 CGAGGGCGGGAACCGGGCGGCGG 0: 2
1: 0
2: 1
3: 28
4: 319
1084588828_1084588835 -3 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588835 11:70078755-70078777 ACCTGCGCCTTGGCGAGGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1084588828_1084588834 -4 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588834 11:70078754-70078776 CACCTGCGCCTTGGCGAGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 156
1084588828_1084588845 23 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588845 11:70078781-70078803 CGGGCGGCGGCAGGGCCTCCTGG 0: 1
1: 0
2: 3
3: 37
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084588828 Original CRISPR GGTGCGCGGCCCTCCCGCCC GGG (reversed) Intronic