ID: 1084588833

View in Genome Browser
Species Human (GRCh38)
Location 11:70078751-70078773
Sequence GCGCACCTGCGCCTTGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084588829_1084588833 -8 Left 1084588829 11:70078736-70078758 CCGGGCGGGAGGGCCGCGCACCT 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588827_1084588833 -1 Left 1084588827 11:70078729-70078751 CCGCGACCCGGGCGGGAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588816_1084588833 28 Left 1084588816 11:70078700-70078722 CCGTCCGAGGGCACGGTGAGTGC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588828_1084588833 -7 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588819_1084588833 24 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084588833 Original CRISPR GCGCACCTGCGCCTTGGCGA GGG Intronic
904813804 1:33181019-33181041 GCGCACCTGCAGCTCGTCGAAGG + Exonic
905449118 1:38046040-38046062 GCGCACCTGCACCCGGGCGCGGG - Exonic
911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG + Intronic
1076881128 10:133239724-133239746 GCGGACCTGCTCCATGGTGAAGG - Exonic
1080384699 11:31804445-31804467 CCCCACCCGCGCCTTGGTGAGGG - Intronic
1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG + Exonic
1083678814 11:64342100-64342122 CCGCAGCTGAGCCTTGGCGTTGG - Exonic
1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG + Intronic
1088432640 11:109775790-109775812 GCTCACCTACGCCTTGGTGGTGG + Intergenic
1091582344 12:1797350-1797372 CCGCACTTCCGCCTTGCCGAGGG + Intronic
1093238338 12:16639544-16639566 GAGCCCCTGCGCCTGGCCGATGG - Intergenic
1102305006 12:111798226-111798248 GCTCACCTCCTCCTTGGCGATGG - Exonic
1106087864 13:26558522-26558544 GCGCGCCTGGGCTTTAGCGAGGG + Intronic
1114626992 14:24136427-24136449 GAGCACCTGCGCCCCGGGGAGGG + Intronic
1121116353 14:91345796-91345818 GAACACCTGCGCCTAGACGATGG + Intronic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1129452111 15:75656965-75656987 GCTCTCCTTCACCTTGGCGAAGG - Exonic
1142173369 16:88634227-88634249 GTGCACCTGCGCCTTGATGTAGG + Intergenic
1142848167 17:2691998-2692020 GCGCACCTGCGTCTTGTAGATGG + Exonic
1142885307 17:2908988-2909010 GAGCCACTGCGCCTTGTCGAGGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1147879294 17:43643578-43643600 TCGCAGCTGCTCCTTGGTGAAGG + Exonic
1148734661 17:49858669-49858691 GCCCACCTGCCCCTGGGCGCCGG - Intergenic
1148880016 17:50718579-50718601 GCAGACCTGTGCATTGGCGAGGG - Intergenic
1152103168 17:78314445-78314467 GCCCACCTGCGCCCTGGGCAGGG - Intergenic
1156502040 18:37566202-37566224 GCGGCCCCGCGCCGTGGCGATGG + Intergenic
1160706495 19:532435-532457 GCCCACCTCCTCCTTGGCGGGGG + Intronic
1162343539 19:10106520-10106542 GCGGAGCTGCGCCTGGGCGCGGG - Exonic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1167244018 19:48363306-48363328 GAGCAGCTGCTCCTTGGAGAAGG + Exonic
1168317155 19:55489353-55489375 GAGCGCCTGCGCCTGGCCGATGG + Exonic
927945840 2:27134663-27134685 GCGCTCCTGCGCCTGCGCGGAGG - Exonic
942147432 2:173040444-173040466 CAGCACCTGGGCCTTGACGATGG - Intronic
948527121 2:238577960-238577982 TCGCACCTTCCCCTTGGTGATGG - Intergenic
1174195848 20:48772339-48772361 GCGCACCTGCGCCTTCTTGGGGG - Intronic
1175863352 20:62161726-62161748 GCGGCCCTGAGCCTGGGCGATGG - Intronic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1181669243 22:24418494-24418516 GCGCACCTGGGCCTTGTCCTGGG + Intronic
1183521958 22:38300717-38300739 ACGCACCTGGGCATTGGTGAGGG - Exonic
1183659021 22:39207440-39207462 ACACACCTGCCCCTTGGCCATGG - Intergenic
1185331859 22:50255557-50255579 GCGGACCTGGGCCTTGGTGTTGG - Intronic
958729725 3:97948990-97949012 AGGCACCTGTGCCTTGGAGAAGG + Intronic
962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG + Exonic
965735010 3:171810419-171810441 TAGCACCTGCGCGTTGGCGGCGG + Exonic
975908340 4:79242229-79242251 GCCCACCTGCACCTTGGAGGGGG + Intronic
985665978 5:1181707-1181729 CCGCACCTGCGCCTGGGTGGTGG + Intergenic
985791618 5:1931215-1931237 GCGCAGCTGCGCCCTGGAGCAGG - Intergenic
986399545 5:7367770-7367792 GTGCACCCTCGCCTTGGTGAGGG - Intergenic
989043130 5:37249356-37249378 GCGAGCCTGCGTCCTGGCGACGG + Exonic
990382850 5:55233182-55233204 GCTCTCCTGCGCCTTGCGGAAGG + Exonic
998517576 5:142770196-142770218 GCGGACCTAGGCGTTGGCGAGGG + Intergenic
1002404996 5:179023791-179023813 GCGCAACTGCGCCTGCGCGCCGG - Exonic
1002524168 5:179806433-179806455 GCGCACCTGGGCGTCGGCGGCGG - Intronic
1003868036 6:10381371-10381393 GGGCACCTGGGCTTTGGGGAGGG - Intergenic
1020058119 7:5132579-5132601 TCCCACCTGCGCCTGGGAGAGGG - Intergenic
1021491051 7:21220416-21220438 TCGCTCCTGGGACTTGGCGATGG + Intergenic
1030261052 7:107564193-107564215 GCCCACCTTCTCCTTGGCTAGGG - Exonic
1032502541 7:132410706-132410728 CCCCACCAGCGCCTTGGGGAGGG - Intronic
1033490686 7:141840786-141840808 GCACACATGTGCCTTGGAGAAGG - Intronic
1035553010 8:544644-544666 CCTCACCTGCGCCTGGGCGGCGG + Exonic
1039616458 8:38958469-38958491 GCGGACCAGCTCCTTGGGGAAGG - Intronic
1045035103 8:98170438-98170460 GCGCACATTCGCCTGGGGGACGG + Intergenic
1048493812 8:134919126-134919148 GGGCACATGCTCCTTTGCGATGG - Intergenic
1062567235 9:137168675-137168697 GCGCGCCTGCACCCTGGGGACGG - Exonic
1192118618 X:68434014-68434036 GCGCACCTGCCCCTTGGGGCCGG - Intergenic