ID: 1084588833

View in Genome Browser
Species Human (GRCh38)
Location 11:70078751-70078773
Sequence GCGCACCTGCGCCTTGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084588828_1084588833 -7 Left 1084588828 11:70078735-70078757 CCCGGGCGGGAGGGCCGCGCACC 0: 1
1: 0
2: 4
3: 24
4: 191
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588829_1084588833 -8 Left 1084588829 11:70078736-70078758 CCGGGCGGGAGGGCCGCGCACCT 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588827_1084588833 -1 Left 1084588827 11:70078729-70078751 CCGCGACCCGGGCGGGAGGGCCG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588816_1084588833 28 Left 1084588816 11:70078700-70078722 CCGTCCGAGGGCACGGTGAGTGC 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084588819_1084588833 24 Left 1084588819 11:70078704-70078726 CCGAGGGCACGGTGAGTGCGGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084588833 Original CRISPR GCGCACCTGCGCCTTGGCGA GGG Intronic