ID: 1084589780

View in Genome Browser
Species Human (GRCh38)
Location 11:70084028-70084050
Sequence CAGTGTCTGCAAAGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 1, 2: 6, 3: 53, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084589780 Original CRISPR CAGTGTCTGCAAAGGCAAGG AGG Intronic
900860594 1:5226547-5226569 CATTGTTTGCAAAGGCTTGGAGG - Intergenic
901034113 1:6326040-6326062 CAGGGTCTCCCAAGGCATGGTGG + Intronic
901326978 1:8372735-8372757 CTCTGTCTGCATGGGCAAGGAGG - Intronic
902264814 1:15255748-15255770 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
902626017 1:17676805-17676827 CAGTGGGTGCAAAGGCCTGGGGG - Intronic
902641149 1:17767172-17767194 CAGCGTCTGCAAAGGCCCTGCGG + Intronic
903555658 1:24191280-24191302 CAGTGTTTGAAAAGGCCAGGGGG - Intergenic
903587126 1:24424652-24424674 CAGTGGCAGGAAAGGCAATGGGG + Intronic
903818795 1:26085045-26085067 CAGCATGTGCAAAGGCCAGGAGG - Intergenic
904016971 1:27429235-27429257 AAGAGTCTCCAGAGGCAAGGAGG + Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904365786 1:30010267-30010289 CAGAGCCTGCAAGGGCAGGGGGG + Intergenic
904862678 1:33550495-33550517 CATTGTCTGCCAACGCCAGGTGG - Intronic
905679803 1:39861239-39861261 CAGTTTCGGGAAGGGCAAGGTGG + Intronic
905709173 1:40086296-40086318 CAGCATCTGCAAAGGCAAAAGGG + Intronic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905974667 1:42165700-42165722 CTGTATCTGCAGGGGCAAGGGGG - Intergenic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
906818398 1:48903019-48903041 CAATTTATGCACAGGCAAGGAGG - Intronic
907016389 1:51018330-51018352 CAGCATTTGCAAAGGCAAAGAGG - Intergenic
907268833 1:53278578-53278600 CAGTGTCTCAAAAGCCCAGGAGG - Intronic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907508022 1:54936018-54936040 CAGTGTTCTCAATGGCAAGGTGG + Intergenic
908482736 1:64558284-64558306 ATGTGCCTGGAAAGGCAAGGAGG - Intronic
908810537 1:67977591-67977613 CAGTGCCTGCAAAAGACAGGAGG + Intergenic
910366643 1:86472371-86472393 CAGTGCCTGCAGAGGAAATGAGG - Intronic
910410051 1:86933658-86933680 CAGAGTCTGAAAAGACAACGCGG - Intronic
910433854 1:87185290-87185312 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
910576999 1:88776220-88776242 CAGTGTCAGGGAGGGCAAGGGGG - Intronic
911069591 1:93822101-93822123 CAGTGTGGGCAAAGGCATTGAGG + Intronic
911283564 1:95961181-95961203 CAGTGTTTGCAAAGGCAACAAGG - Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912510301 1:110185182-110185204 CAGTTTCCGCAATGGCAAGATGG + Intronic
912776834 1:112510721-112510743 CAGTGTTGGGGAAGGCAAGGAGG + Intronic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913733039 1:121737725-121737747 TAGCATCTGCAAAGGGAAGGTGG - Intergenic
913733184 1:121739589-121739611 TAGCATCTGCAAAGGGAAGGTGG - Intergenic
913785983 1:122453310-122453332 TAGCATCTGCAAAGGGAAGGTGG + Intergenic
913787241 1:122470300-122470322 TAGCATCTGCAAAGGGAAGGTGG + Intergenic
914430439 1:147615944-147615966 CAGTGACTGCAAAGGAAAGGAGG + Intronic
914769137 1:150667921-150667943 CAGTGTGTGCAAAGGCCAATAGG - Intronic
915079664 1:153343414-153343436 CAGCCTCTGAAAAGGGAAGGGGG - Intronic
915784890 1:158598871-158598893 CAGTGTCTTCTAAGGCAAAGAGG + Intergenic
917843786 1:179003678-179003700 CAGTGTGTGAAAAGCCAAGCTGG + Intergenic
922024772 1:221740230-221740252 CACTCGCTGCAAAGGCAAAGGGG + Intronic
922696092 1:227731805-227731827 CAGGCCCTGCAAAGGCAGGGAGG + Exonic
923712538 1:236398630-236398652 CAAAGTTTGCAAAGGCCAGGAGG - Intronic
1063299728 10:4840686-4840708 CAGTATTTGCAAAGGCACAGAGG - Intronic
1064233078 10:13547089-13547111 CAGTATGTGCAAAGGAATGGAGG + Intergenic
1064618689 10:17191979-17192001 CAGTGTCAGATGAGGCAAGGTGG + Intronic
1064853294 10:19735167-19735189 CAATCTCTTCAAAGGCAATGAGG + Intronic
1065361613 10:24894470-24894492 CAGGCTCTGGACAGGCAAGGTGG + Intronic
1066517628 10:36181454-36181476 AAGTGGCTGCAACTGCAAGGAGG + Intergenic
1067308108 10:45085222-45085244 CAGTCTCTGGAAAGTTAAGGAGG + Intergenic
1068132895 10:52916828-52916850 CGGTCTATGCAAAGGCAAAGTGG + Intergenic
1068602270 10:58968501-58968523 CAAATTCTTCAAAGGCAAGGAGG - Intergenic
1069779655 10:70946687-70946709 CAGTTTCTGCCAAGTCTAGGTGG + Intergenic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1070743405 10:78917560-78917582 AAATGTCAGTAAAGGCAAGGTGG + Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1071430580 10:85603322-85603344 CCCTGTCTGGAAGGGCAAGGGGG + Intronic
1073383435 10:103100364-103100386 CAGTGTCAGGAAAGTCAGGGTGG - Intronic
1074964141 10:118473905-118473927 TATTGTTTGCAGAGGCAAGGTGG - Intergenic
1075485662 10:122820195-122820217 CAGAGCATGCAAAGGAAAGGAGG - Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076218445 10:128714319-128714341 CAATGTCTGCAAAGGCAGTTGGG + Intergenic
1076414291 10:130274272-130274294 CAGAGGCTGGAAAGGCAAGGAGG - Intergenic
1077297992 11:1834975-1834997 CTGGGTCTGCCAGGGCAAGGAGG - Intronic
1077470030 11:2753330-2753352 CCGTGTCTGCCCAGGGAAGGAGG + Intronic
1079094789 11:17503204-17503226 CAGTGAATGCACAGGCAAGAAGG + Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1081674029 11:44957822-44957844 CAGCGTTTGCAAAGGCCAGGAGG - Intergenic
1082620739 11:55418520-55418542 CAGTGACTGCAAAGGTAACTGGG + Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083281581 11:61630005-61630027 TAGCATCTGCAAAGCCAAGGAGG - Intergenic
1083737195 11:64688160-64688182 CAGTGGCTGCCAAGGCCAAGTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084452167 11:69245627-69245649 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084923016 11:72487188-72487210 CCATGTCTGCAAAGGCCAAGTGG + Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085206378 11:74734986-74735008 CAGTGTTTGCAGAGTCATGGAGG - Intergenic
1085403707 11:76249451-76249473 CAGTGTCTGCAAAGGCCAAGAGG + Intergenic
1086596302 11:88575518-88575540 CAATGTCTGCATGGGCAAGGTGG + Intronic
1088123380 11:106395363-106395385 ATGTGGCTGCCAAGGCAAGGGGG + Intergenic
1088425492 11:109696994-109697016 CAGTCTCTGCAGAGAAAAGGTGG - Intergenic
1089027836 11:115290161-115290183 CAGTGTCTGCAGAGGCCTGGTGG + Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1090422815 11:126587277-126587299 CAGCGTGTGCAAAGGCTGGGAGG + Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1093017690 12:14171160-14171182 CAGTGACTGCCCAGGGAAGGGGG + Intergenic
1093445307 12:19250228-19250250 CAGTGACTACAGAGACAAGGTGG + Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1095494159 12:42767512-42767534 CAGTGCCTTTAAAGGGAAGGTGG + Intergenic
1095826003 12:46531071-46531093 CAGGGCCTGCAAGGGCAAGGTGG - Intergenic
1095929377 12:47610359-47610381 CAGTGTGTGCATAGGCACTGAGG - Intergenic
1098360947 12:69654021-69654043 CAATGGCTGCAAGGGCACGGGGG + Exonic
1098371878 12:69768483-69768505 CAGTGTATGCCCAGGAAAGGTGG + Intronic
1098597924 12:72295009-72295031 CTGAGCCTGCAAGGGCAAGGGGG + Intronic
1098875240 12:75860129-75860151 CAGTGTCTGAAAAAGCCAGCTGG + Intergenic
1099743275 12:86669066-86669088 CAATCTCTGCACAGGAAAGGTGG - Intronic
1100793588 12:98156863-98156885 TAGTGTGTGCAAAGACATGGAGG + Intergenic
1101659490 12:106753255-106753277 CAATTTCTGCAAAGACATGGAGG - Intronic
1101904817 12:108816670-108816692 CAGAGTCTGCCAAGGGAAGCAGG - Intronic
1102688214 12:114740658-114740680 CAGTTTCTGCAAAATCACGGTGG + Intergenic
1103015674 12:117492732-117492754 CAGGGTCTTCAAAAGCAAAGGGG + Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103282390 12:119770721-119770743 TAGAGTTTGCAAAGGGAAGGGGG - Intronic
1103904195 12:124319129-124319151 CTGTGTGGGCAAAGGCTAGGAGG - Intergenic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1105490476 13:20883094-20883116 CAGGGCCTGCAAGGGCAGGGCGG - Intronic
1105889797 13:24674442-24674464 CAGTGTCTGCAAAGCCCACCTGG + Intergenic
1106326897 13:28700340-28700362 CAGTGTGTGAAAAGACATGGAGG + Intronic
1106402695 13:29444994-29445016 CAGTGTCTGCAAATGTACTGGGG - Intronic
1107297085 13:38921188-38921210 CAATCTCTGCAAAGGAAGGGTGG + Intergenic
1107853359 13:44591766-44591788 CTGAGTCTGCAAGGGCATGGGGG - Intergenic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1112078288 13:95936743-95936765 CAGTCTCTGCACAGGCAGGGTGG + Intronic
1112713170 13:102153705-102153727 CAGAGGCTGGGAAGGCAAGGAGG - Intronic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113467595 13:110523332-110523354 CTGCCTCTGCAAGGGCAAGGGGG + Exonic
1114716329 14:24829551-24829573 CAGTGTCTGCAAAGTCTCAGAGG - Intronic
1114764753 14:25358322-25358344 CAGTGTCAGAACAGGAAAGGTGG - Intergenic
1114814228 14:25937626-25937648 CAGTGTTTAAAAAGGAAAGGAGG - Intergenic
1114834774 14:26191021-26191043 AATTGTATGCAAAGGCATGGAGG + Intergenic
1117186725 14:53247291-53247313 CAGTATATGCAAAAGCACGGAGG + Intergenic
1118009381 14:61593938-61593960 CAGCATATGCAAAGGCAAAGAGG + Intronic
1118410180 14:65470247-65470269 CCGAGCCTGCAAAGGCAAGGGGG + Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120637404 14:86969056-86969078 CAGCATCTGCAAAGGAAAGTGGG - Intergenic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122371728 14:101232913-101232935 CAGAGTTTGCAAAGGCCAAGAGG + Intergenic
1122466689 14:101938553-101938575 CAGCGTGTGCAAAGGCACTGGGG - Intergenic
1122970062 14:105148853-105148875 CAATGTCTGCAGAGGCGAGCGGG + Exonic
1124208405 15:27742601-27742623 CACTGTCTGCAGAAGCAAGCTGG + Intergenic
1124961006 15:34394839-34394861 CAGTGGCTTCAAAGCCAAAGTGG - Intronic
1124977636 15:34541060-34541082 CAGTGGCTTCAAAGCCAAAGTGG - Intronic
1125387783 15:39156543-39156565 CATGGTCTGGAAAGGCAGGGAGG - Intergenic
1125721264 15:41846186-41846208 CCTTGTCTACACAGGCAAGGTGG - Exonic
1126368680 15:47922701-47922723 CAGATTGTGTAAAGGCAAGGAGG + Intergenic
1127712163 15:61610231-61610253 GAGTGGCTGGAAAGGCAGGGTGG + Intergenic
1128325910 15:66724032-66724054 CAGCTTGTGCAAAAGCAAGGAGG + Intronic
1128796400 15:70469784-70469806 CAGTGTGTGCAAAGGCACAAAGG + Intergenic
1129002733 15:72347602-72347624 CAGTCTCTGTAGAGGCAGGGAGG + Intronic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129296799 15:74604281-74604303 CGGAGTCTGCAAATGAAAGGTGG - Intronic
1129888604 15:79056155-79056177 CAGCATGTGCAAAGGCCAGGAGG + Intronic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131640121 15:94283409-94283431 CAGCCTGTGCAAAGCCAAGGGGG - Intronic
1132245872 15:100295689-100295711 CAGTGTCTGCACGAGCAAAGAGG - Intronic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1133410935 16:5568269-5568291 CAGCTTGGGCAAAGGCAAGGAGG - Intergenic
1133631474 16:7626129-7626151 AAGCCTCTGCAAAGGCATGGAGG + Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1134667768 16:16031625-16031647 CAGTGTGTGCAAAGGCCCGGTGG - Intronic
1134811467 16:17170569-17170591 CAGCTTTTGCAAAGGCAAGCAGG - Intronic
1135195055 16:20387400-20387422 CAGTGTATGCAAAGGCCCTGAGG + Intronic
1135825213 16:25721168-25721190 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1135962892 16:27012480-27012502 CAGTGACTGCAAAGGCCCTGAGG - Intergenic
1136077892 16:27829323-27829345 TAGTGTGTACAAAGGCATGGAGG + Intronic
1136418599 16:30118225-30118247 CAGTGGAGGCAAAGACAAGGGGG - Intronic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1138502300 16:57454771-57454793 CAGAAACTGCACAGGCAAGGTGG + Intronic
1138532651 16:57643221-57643243 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1138853024 16:60653063-60653085 CAGTTTATTCAAAGGCAAAGAGG + Intergenic
1139456890 16:67087021-67087043 CAGTGTATGCAAAGGCATGGAGG + Intronic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1141404816 16:83783237-83783259 GTGTATCTGTAAAGGCAAGGAGG - Exonic
1141621048 16:85236568-85236590 CAGTGTGTGCATAGGCCTGGGGG + Intergenic
1141624416 16:85253748-85253770 CTGTGCGTGCAAAGGCCAGGAGG + Intergenic
1141624430 16:85253821-85253843 CTGTGTGTGCAAAGGCCAGGAGG + Intergenic
1141624447 16:85253893-85253915 CTGTGTGTGCAAAGGGCAGGAGG + Intergenic
1141887579 16:86903176-86903198 TAGTGTCTCCAAAGCCCAGGGGG - Intergenic
1142288828 16:89183340-89183362 CCCTGTCTGCTAAGGGAAGGTGG + Intronic
1143199238 17:5100658-5100680 TGGAGTCTGTAAAGGCAAGGAGG - Intergenic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143611823 17:8022292-8022314 CAGGCTCTGAAAAGGCAATGAGG + Intergenic
1144179100 17:12735105-12735127 CAGGGATTGCAAAGGCAACGAGG - Intronic
1144356668 17:14453158-14453180 CATTTTCTGCAAACACAAGGGGG + Intergenic
1144482690 17:15640561-15640583 CAGTGTTTGCAATGTCAAGGAGG - Intronic
1144915998 17:18724471-18724493 CAGTGTTTGCAATGTCAAGGAGG + Intronic
1144954277 17:19011343-19011365 CTACGTCTGCAAAGGCATGGAGG + Intronic
1145907653 17:28525057-28525079 CAAGGTCTGCAAAGAGAAGGTGG - Intronic
1147315269 17:39617420-39617442 CTGAGTCTGCAAGGGCTAGGAGG - Intergenic
1148093982 17:45039843-45039865 CAGTGGCTGTAAGGCCAAGGTGG + Intronic
1149020472 17:51957782-51957804 GAGTATCTGCAAAGGCTTGGAGG - Intronic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1152181656 17:78825845-78825867 GAGGGCCTGCAAAGGCAAGTAGG - Intronic
1152459915 17:80437150-80437172 CAGCATCTGCAGAGTCAAGGAGG - Exonic
1152473921 17:80505292-80505314 CAGTGTCTGGAGAGGCAGTGAGG + Intergenic
1152603535 17:81277574-81277596 CAGAGTCGGCACAGACAAGGAGG + Intronic
1154466177 18:14643920-14643942 GAGTGTCTGCAGGGGCCAGGTGG + Intergenic
1155309432 18:24509611-24509633 CAGTGTCTGCAAATGCTTGGGGG - Intergenic
1155342150 18:24823650-24823672 CAGTGTCTCCCAGGCCAAGGTGG + Intergenic
1155664332 18:28290137-28290159 ATGTGTCTTCAAAGCCAAGGAGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157400070 18:47379819-47379841 CAGTGTGTGCAAAGGCCCAGAGG - Intergenic
1157473866 18:48009188-48009210 CAGTGTCTTCAAGGGCAAAAGGG - Intergenic
1157482448 18:48064209-48064231 CAGTGGTTGGAATGGCAAGGTGG - Intronic
1157790878 18:50529844-50529866 CAGAATCTGCCAGGGCAAGGTGG - Intergenic
1157954203 18:52077983-52078005 CAATATTTGCAAAGACAAGGTGG + Intergenic
1158140972 18:54255289-54255311 CATTGTCTGCTCAGGCAAAGAGG + Intergenic
1158198170 18:54910901-54910923 CCGAGCCTGCAAGGGCAAGGGGG + Intronic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160738511 19:675605-675627 GAATGTCTGCAAAGGCTTGGAGG + Intergenic
1161346553 19:3771305-3771327 CAGTGTGTGCAAAGACATGGAGG - Intronic
1161404285 19:4083009-4083031 CGGTGTCAGCAAAGGCTGGGTGG - Intergenic
1161433749 19:4249644-4249666 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161479926 19:4505366-4505388 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161637209 19:5396437-5396459 CAGTATAAGCAAAGGCTAGGAGG + Intergenic
1161868855 19:6854911-6854933 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
1162879440 19:13647285-13647307 CAGTCTCTGTGCAGGCAAGGAGG + Intergenic
1163075997 19:14892228-14892250 AAGTGTCGGAACAGGCAAGGTGG + Intergenic
1163544089 19:17930689-17930711 CAGTATATGCAAAGGTGAGGAGG - Intergenic
1163587472 19:18171958-18171980 CAGTGCCTGGCAAGGCTAGGGGG - Intronic
1164554374 19:29239658-29239680 CATTGTCTGGAAAGACAGGGGGG - Intergenic
1165075795 19:33279215-33279237 AAGTGACTGCCTAGGCAAGGAGG - Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1166273179 19:41731147-41731169 CTGTTTGTTCAAAGGCAAGGTGG + Intronic
1166511242 19:43410354-43410376 CAGTGTGAGCAAAGCCAAAGAGG + Intronic
1168251460 19:55144659-55144681 CAGTGTGTGCAAAGGCTCAGGGG + Intronic
1168264632 19:55215778-55215800 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
925584735 2:5453307-5453329 AAGTGGCTGCACAGGCCAGGTGG + Intergenic
925982671 2:9189917-9189939 CAGTGTGTGCAGAGTCAAAGGGG - Intergenic
926630133 2:15128619-15128641 CAGGGTGTGCAATGGCATGGAGG + Intergenic
926689017 2:15720019-15720041 CAGGGTCTGTAAAGGCTGGGTGG - Intronic
926755212 2:16228946-16228968 TAGTGTATGCAAAAGCATGGAGG - Intergenic
927138057 2:20111739-20111761 CCCTGACTGCACAGGCAAGGTGG - Intergenic
927484041 2:23476906-23476928 ATGTGCCTGCAGAGGCAAGGAGG + Intronic
928436278 2:31256681-31256703 CTGTGTCTGCAAAGGCTGAGGGG - Intronic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931390733 2:61841370-61841392 CCATGTATGCAAAGGCAAGATGG - Intronic
931463497 2:62467802-62467824 CACAGTCTGCAAAGGCCAGGTGG + Intergenic
931558434 2:63530865-63530887 CAGTGTGAGCCAAAGCAAGGCGG + Intronic
931667910 2:64623443-64623465 CAGTGTGTGCAAAGGCCAAGAGG + Intergenic
932471968 2:71965196-71965218 CACTGACTGCAAATGCCAGGAGG + Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
933530481 2:83504155-83504177 AAGTGTCTATAAAGGCAATGGGG + Intergenic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934219080 2:90065007-90065029 CAGTGTCAGCACAGACAAAGTGG + Intergenic
934606438 2:95699056-95699078 CAGTTTCTGCAGACTCAAGGGGG + Intergenic
934906892 2:98213095-98213117 CTGTGTCTGGAAAGACAAGAAGG + Intronic
935578598 2:104736210-104736232 CAGTCTCTGCTGAGGCAAAGCGG - Intergenic
935801665 2:106703301-106703323 CAGAGACTTCAAAGGCAACGAGG - Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936910670 2:117589350-117589372 AATTGTCTGGAAAGGCAATGGGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938582874 2:132663106-132663128 TAGTGTCTGGAAAGGAAAGGAGG + Intronic
939866954 2:147483443-147483465 CAGTGTCTGCAAAGCTGAGCTGG + Intergenic
940661225 2:156547407-156547429 AAGTGTGTGTAAAGGCAAGGTGG + Intronic
942470595 2:176255818-176255840 CAGTAGCTGCAAAGGAAATGAGG - Intergenic
944968901 2:204968591-204968613 CAGTATCTGCAAAGGCACAGAGG - Intronic
945041685 2:205747946-205747968 CAGAGACTTCAAAGGAAAGGAGG - Intronic
946153770 2:217793812-217793834 CAGATTCTGCAAATGCAAGAGGG + Intergenic
946166781 2:217869336-217869358 CAGCCTCTGAAAAGGCAGGGAGG + Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946426202 2:219598404-219598426 CAGTGTCAGAGAAGGCACGGAGG - Intronic
946756211 2:222950503-222950525 CAGTGTCTACAAAGGCTCAGAGG - Intergenic
947926591 2:233927048-233927070 CAGTGTCAGCAAAGCCAGGCAGG - Intronic
948051513 2:234982648-234982670 CAGTTTTTGCACAGGCAGGGAGG + Intronic
948463623 2:238141987-238142009 CAGCTTGTGCACAGGCAAGGAGG + Intronic
948640251 2:239371143-239371165 AGGTGTCTGCACAGACAAGGTGG - Intronic
948644456 2:239395106-239395128 CAGTGTGTGCAAAGGCCCCGAGG + Intronic
948710106 2:239820026-239820048 CAGGGTCTGCAGGGGCAAAGGGG + Intergenic
948856179 2:240731747-240731769 CAGTGTCAGCCAGGGCGAGGGGG - Intronic
1168738760 20:169366-169388 AAGTCTCTGCCTAGGCAAGGGGG + Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1168956908 20:1840942-1840964 CAGTGAGTGCAAAGGCCCGGAGG + Intergenic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169935985 20:10883849-10883871 CATTCTCTGAAAAGGGAAGGGGG - Intergenic
1170905857 20:20514775-20514797 CAGTCTCTGCACAAGAAAGGTGG - Intronic
1170932356 20:20780673-20780695 CACTGTCTGCCAAGCCAAGAAGG + Intergenic
1170960386 20:21020277-21020299 CTGTGTCTGCACATCCAAGGCGG - Intergenic
1171170859 20:23014296-23014318 CAGTGTGTGCAAAGGCCCTGGGG + Intergenic
1172808235 20:37628648-37628670 CAGCATGTGCAAATGCAAGGAGG - Intergenic
1172972355 20:38882874-38882896 CAGTGTGTGCAAAGGCCTGGAGG + Intronic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173476846 20:43365633-43365655 CAATGTCAGTAGAGGCAAGGTGG - Intergenic
1173689636 20:44950412-44950434 CAGTGTCTTAAAACACAAGGAGG - Intronic
1173966416 20:47115935-47115957 CAGTGTGTGCAAAGGCCCTGTGG - Intronic
1174583906 20:51592761-51592783 CAGTGTGTGCAAAGGCCCCGGGG - Intergenic
1174684924 20:52445544-52445566 CAGTGAGTGCAAAGGCCAGGTGG + Intergenic
1174866135 20:54137414-54137436 CAGTGAATGCAAAGGCCATGAGG - Intergenic
1175123772 20:56736573-56736595 ATGTTTTTGCAAAGGCAAGGGGG - Intergenic
1179045877 21:37844646-37844668 TAGTGCTTGCCAAGGCAAGGAGG - Intronic
1180030019 21:45200503-45200525 CAGAGTCGGCTATGGCAAGGGGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1182017850 22:27055880-27055902 CAGTGTATGCAAAGGCCCTGAGG + Intergenic
1182060154 22:27391549-27391571 CAGTGAGTGCAAAGGCCTGGAGG + Intergenic
1183921044 22:41168772-41168794 CAATTTCTTCAAAGGCAAAGAGG - Exonic
1184054339 22:42034205-42034227 CCATGCCTGCAAGGGCAAGGGGG + Intronic
1184199305 22:42954981-42955003 CAATATATGCAAAGGCAAGGAGG - Intronic
1184502417 22:44882127-44882149 TAGTGTCTGCACTGGCAAGAAGG + Exonic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1185227119 22:49659518-49659540 CAGTGGCTGCAGAGACGAGGGGG + Intergenic
949138572 3:602606-602628 CAGTGTCTACACAGTCAAGTAGG + Intergenic
950173676 3:10856659-10856681 GAATGTTTGCCAAGGCAAGGAGG - Intronic
952632194 3:35482722-35482744 TGGAGTCTACAAAGGCAAGGAGG + Intergenic
952815332 3:37442554-37442576 TTCTGACTGCAAAGGCAAGGTGG - Intergenic
953085645 3:39664106-39664128 CAGTATCTCCAAGGGCAAAGAGG - Intergenic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953531668 3:43745357-43745379 AAGTCACTGCAAATGCAAGGAGG + Intergenic
953704180 3:45218913-45218935 CAGTGTCAGCACAGGCTTGGAGG + Intergenic
953878732 3:46680794-46680816 GAGTGTGTGCAAAGCCATGGAGG + Intronic
954072180 3:48151030-48151052 AGGTGTCAGCAAAGGTAAGGAGG + Intergenic
954623742 3:52010803-52010825 CAGAAGCTGGAAAGGCAAGGAGG + Intergenic
955284639 3:57627504-57627526 CAGTTTCTCCAAAGACAAGAAGG - Exonic
955896439 3:63705693-63705715 TGGTGTGAGCAAAGGCAAGGAGG + Intergenic
956167257 3:66406052-66406074 CTGTGTCTGCAAGGGCTCGGGGG - Intronic
956462413 3:69485293-69485315 CAGAGCCTGCAAGGGCAAGTGGG + Intronic
956678893 3:71759667-71759689 CACTGTACGCAAAGGCATGGTGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956870384 3:73411454-73411476 AGGTGTGAGCAAAGGCAAGGTGG + Intronic
957225199 3:77434187-77434209 CAATGTATTCAAAGGCAAGAAGG - Intronic
959086378 3:101854697-101854719 CAGAGTCTGAAATGGCAAAGAGG + Intronic
959692350 3:109211442-109211464 CAGTGTGTGCATAGTCAAAGAGG - Intergenic
960044712 3:113185716-113185738 CAGTGTCTACAAAGACAGTGGGG + Intergenic
962253978 3:133857951-133857973 CTGTGTGTGGAAGGGCAAGGAGG - Intronic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
964370074 3:155991180-155991202 CAGACTCTGCAAATGAAAGGCGG - Intergenic
964531090 3:157668690-157668712 GTGTGTATGCAAAGGTAAGGGGG - Intronic
965425174 3:168514049-168514071 CAGCCTCTGCAAAGTGAAGGGGG + Intergenic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
968976670 4:3825693-3825715 CTGGGTCTGGAAAGCCAAGGTGG - Intergenic
969056442 4:4405661-4405683 CAGAGTCTGCACAGGGCAGGGGG + Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969335124 4:6503252-6503274 CAGTGGCTGCAAAGGCCCTGAGG - Intronic
969571481 4:8011277-8011299 CAGTGTTTGCAAAGGAAACTTGG - Intronic
971300914 4:25441800-25441822 CAGTGTGTGCAAAAGCTTGGAGG + Intergenic
971379693 4:26085469-26085491 CAGAGGATGTAAAGGCAAGGAGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972950962 4:44321757-44321779 CAGAGGCTACAAAGGAAAGGAGG - Intronic
973550080 4:52025442-52025464 CAGTGTCTGCAAAGGCCCCGAGG + Intronic
977155435 4:93567052-93567074 AAAGGTCTGCAAAGGGAAGGTGG - Intronic
977490594 4:97705190-97705212 CAGTATATGCAAAGTCAAAGAGG - Intronic
978679566 4:111363199-111363221 CAGTCCCTGCAAAGGCAGGAAGG - Intergenic
981228836 4:142329024-142329046 CAGCGCATGCAAAGGCATGGAGG - Intronic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
982158147 4:152540934-152540956 CAGGGCCTGCAAGGGCAAGGGGG + Intergenic
983768328 4:171516321-171516343 CAGTGTTTGGAAAGCCAAAGTGG + Intergenic
983899822 4:173122094-173122116 CAGTGTGTGCAAAGGCACAGAGG - Intergenic
984201715 4:176729628-176729650 AAGTGTCAGCTAAGGAAAGGAGG - Exonic
984342074 4:178470049-178470071 CAGAATCTGCAAAGCCAATGGGG - Intergenic
984673678 4:182522340-182522362 CAGTGGCTGCAAAGTGAAAGCGG - Intronic
985045150 4:185933168-185933190 CAGTGTCTCCAAAGGCAGTACGG + Intronic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
988445468 5:31281550-31281572 CACAGTCTGCCAAGGCAAGAGGG + Intronic
988598974 5:32621855-32621877 TAGTGTCTGGAAAGGCAGGTGGG - Intergenic
988854079 5:35210105-35210127 CAGTACCTGCAAAGGCACTGAGG - Intronic
989518815 5:42376765-42376787 TAGTGTCTTCATAGGCCAGGTGG + Intergenic
989609483 5:43277529-43277551 CAATGTCTGCAGAAGCTAGGAGG - Intronic
989664912 5:43842672-43842694 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990856979 5:60279401-60279423 TAGTGTCAGAAAAGGCAAGGAGG - Intronic
991400256 5:66244360-66244382 GAGTCTCTGCAAAGGCCTGGAGG - Intergenic
991950516 5:71943126-71943148 CAGTCTCTACAAAGGTCAGGTGG + Intergenic
992205827 5:74429636-74429658 CAGTGGGTGCAAAGGAATGGGGG - Intergenic
994261676 5:97666474-97666496 CAGTATCTGCAAAGGCAGCACGG + Intergenic
994626463 5:102226252-102226274 CAGTGTCTGCCAAGAGAAGATGG - Intergenic
995148210 5:108810640-108810662 CAGTCTCTGCACAGGAATGGTGG + Intronic
997201514 5:132012547-132012569 CAGTGTCTGCCATTGAAAGGAGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997336871 5:133114801-133114823 CAGTGACTGCAAAAAGAAGGCGG - Intergenic
997758077 5:136419318-136419340 CAGGGTCTGCCAAGGCGAGGAGG + Intergenic
999190187 5:149741478-149741500 CTGCTTCTGCAAAGGCAGGGTGG - Intronic
999686474 5:154107770-154107792 TAGTATCTGCAAAAGGAAGGAGG + Intronic
1001163020 5:169338166-169338188 CAGAGTCTGCACTTGCAAGGAGG - Intergenic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1001422770 5:171599948-171599970 CAGTTTCTGCAGCAGCAAGGGGG + Intergenic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1001709620 5:173767906-173767928 CAGCATCTTCAAAGACAAGGGGG - Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1001949491 5:175806265-175806287 CAGCATCTGCAAAGACACGGGGG - Intronic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002521969 5:179797124-179797146 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1002986119 6:2191527-2191549 CCGAGCCTGCAAGGGCAAGGCGG - Intronic
1003073266 6:2961017-2961039 CAGTAGCTGGAAAGGCAAGGAGG + Exonic
1004063825 6:12223572-12223594 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1004449413 6:15730972-15730994 CTGTGTCTGGAAAGGCAGGAGGG - Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1004943258 6:20584302-20584324 CAGTGTGCTTAAAGGCAAGGGGG + Intronic
1006275523 6:33002241-33002263 TAGTTTGTGCAAAGGCAGGGAGG + Intergenic
1007075685 6:39064771-39064793 CAGGCCCTGCAGAGGCAAGGCGG - Intronic
1007253705 6:40513892-40513914 CAGTGTGTGCAAAGTCTCGGGGG + Intronic
1007289564 6:40775179-40775201 CAGCATGTGCAAAGGCAAGCAGG - Intergenic
1008505464 6:52225629-52225651 CAGTGTGTGCATGGGCACGGTGG - Intergenic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1010714967 6:79217930-79217952 CAGGGACTGCCAAGGCAAAGGGG + Intronic
1011206568 6:84905524-84905546 CAGTGTTAGCAAGGGCAATGGGG + Intergenic
1011577522 6:88819323-88819345 CAGTAACAGGAAAGGCAAGGCGG + Intronic
1011833547 6:91403277-91403299 CATTGTTTGGAAAGGAAAGGTGG - Intergenic
1011957207 6:93037744-93037766 CAGTCTCTGCACAGGAAGGGTGG + Intergenic
1012598688 6:101069411-101069433 CAGTGTATGCTAAGGAAATGGGG - Intergenic
1013654002 6:112226399-112226421 TAGTATATGCAAAGGCAAGGCGG - Intronic
1014205954 6:118655545-118655567 CAGTGTCTGAAAAAGCAGGCAGG - Intronic
1015285734 6:131485041-131485063 GAGTGTGTGCATATGCAAGGTGG + Intergenic
1015633766 6:135255922-135255944 CAGCGTGTGCAAAGCCAGGGAGG - Intergenic
1016349827 6:143155331-143155353 CAGCATGTGCAAAGACAAGGGGG + Intronic
1018073737 6:160191062-160191084 TAGTGTTTGCAATGGCAATGGGG - Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1019549937 7:1597050-1597072 CAGTGTATGTAAAGGCTCGGAGG + Intergenic
1019698209 7:2459744-2459766 CAGTCTCTGCAATGGGAGGGTGG + Intergenic
1022026060 7:26448911-26448933 CAGTCTGTGAAAAGGCAAGACGG + Intergenic
1023022088 7:36019602-36019624 CACTGTCTGCAGAGAGAAGGGGG - Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023848870 7:44139608-44139630 GAGTGACTGCACAGGGAAGGTGG + Intronic
1024160846 7:46673910-46673932 GAGTGTCTGCAAAGGCCGAGAGG - Intronic
1024729410 7:52237473-52237495 AAGTTTCTGTAAAGTCAAGGAGG + Intergenic
1028868351 7:95738238-95738260 CAATGTCTGCACAGGAAGGGTGG - Intergenic
1029133522 7:98351548-98351570 CATTGTCTCCAAAGGCAGGAAGG - Intronic
1029610257 7:101622843-101622865 CACTGTCTGGAAAGTCAGGGGGG - Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030101663 7:105952276-105952298 CAGTTTAGGCAAAGGCATGGAGG + Intronic
1030624594 7:111830908-111830930 CAGTGCCTGCTACTGCAAGGAGG - Intronic
1030754176 7:113268557-113268579 CAGTCTCTGCACAGGAAGGGTGG - Intergenic
1030896558 7:115068377-115068399 CAGTGTTTGCCAAGGGCAGGAGG + Intergenic
1031265212 7:119572537-119572559 CCAAGTCTGCAAGGGCAAGGGGG - Intergenic
1031273341 7:119684070-119684092 CAGTGTATGCCAAGGCATGGAGG + Intergenic
1032098939 7:128956932-128956954 AAGTGTCTGTAAGGGGAAGGGGG + Intronic
1032878913 7:136067641-136067663 AAATTTCTGCAAATGCAAGGAGG - Intergenic
1033458877 7:141527512-141527534 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1035136265 7:156706038-156706060 CTGTGTCTTCATAGGTAAGGTGG - Intronic
1035422764 7:158742905-158742927 CAGTCTCTGCCGGGGCAAGGAGG + Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1037685959 8:21139603-21139625 AAGTATCTGCAAATGCACGGAGG + Intergenic
1038360811 8:26874050-26874072 AAGTGCCTGTAAAGGCAAGGAGG - Intergenic
1038659189 8:29482071-29482093 CAGTGAGTGCAAATGGAAGGTGG + Intergenic
1039297559 8:36173059-36173081 CAGTGTGTACAAAGGCCTGGAGG + Intergenic
1039493296 8:37963902-37963924 CACTGACTGCACAGGCAAGCCGG + Exonic
1040805823 8:51395216-51395238 TAGTGTCTACAAAGTCAAGGAGG - Intronic
1040876547 8:52158505-52158527 CAGTGTCTGCAAATCAAAGAAGG - Intronic
1041342972 8:56865582-56865604 CAGTGTCTGGAAAGGCATTCAGG - Intergenic
1041445628 8:57948462-57948484 CAGTGTCTGAACAAGAAAGGTGG + Intergenic
1041454186 8:58039907-58039929 CACTGTCTCCACAGGCACGGTGG - Intronic
1041564811 8:59264675-59264697 CAGTGTCTGCAATGCCAAGTTGG + Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043304044 8:78771812-78771834 CAGTGGCTGCAACAGAAAGGGGG - Intronic
1045213630 8:100124825-100124847 CAGCATTGGCAAAGGCAAGGAGG + Intronic
1045868526 8:106898096-106898118 CCGTGATTCCAAAGGCAAGGTGG + Intergenic
1045918057 8:107497125-107497147 CAGTGTTTGCAATTGCAAGACGG - Intronic
1047182353 8:122601605-122601627 CTTTTTCTGCAAAGGCAAGATGG - Intergenic
1047597373 8:126392499-126392521 GAGTGTCTGGAAAGGTAAGGAGG + Intergenic
1047766326 8:127992855-127992877 CGGTGTCACCAAAGGCCAGGAGG - Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048215021 8:132486331-132486353 CAGTGTAGGCAAAGGCTTGGAGG + Intergenic
1048278360 8:133084782-133084804 CTGTGCCTCCACAGGCAAGGGGG + Intronic
1048575736 8:135688660-135688682 CAGCGCAGGCAAAGGCAAGGAGG - Intergenic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1050196016 9:3085446-3085468 AAGTGTCTGGTAAGGTAAGGTGG - Intergenic
1051342780 9:16127216-16127238 CAGTTTATGCAAAGACCAGGAGG - Intergenic
1051795550 9:20865304-20865326 TAGAATATGCAAAGGCAAGGAGG + Intronic
1053161318 9:35815128-35815150 AAGTGGCTGCAGAGGCAATGGGG - Intronic
1056919550 9:90774228-90774250 CAGTTTCTGCATCTGCAAGGAGG - Intergenic
1057507730 9:95649715-95649737 AAGTATTTGCAATGGCAAGGAGG - Intergenic
1057739461 9:97699020-97699042 CAGCGTCTGTACAGGCACGGGGG + Intergenic
1057767577 9:97935503-97935525 CAGTGTCAGCAGTGCCAAGGTGG + Intronic
1058281076 9:103115503-103115525 CAATGCCTGCAAAGGCCAAGTGG + Intergenic
1058419902 9:104823693-104823715 CAGTACCTACAAAGGCATGGAGG + Intronic
1058956565 9:109954192-109954214 CAGTCTCTGAAAAAGCAAAGGGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059488178 9:114643515-114643537 CAGCTTCTGCAAAGGCCAGGGGG - Exonic
1059978583 9:119744448-119744470 CAGTGTATGCAAAGGCCCTGAGG + Intergenic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1060263649 9:122096371-122096393 CAATGTTTACAAAGGCATGGAGG - Intergenic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1061887498 9:133599188-133599210 CAGTGTGTGCAAAGGCCAGGAGG - Intergenic
1061943191 9:133893950-133893972 CAGTTTCTGCAGATGTAAGGTGG - Intronic
1062654074 9:137593103-137593125 CAGTGGCTGGAAAGGGATGGGGG - Intergenic
1203618757 Un_KI270749v1:97743-97765 CAGTGTCTACACAGTCAAGTAGG - Intergenic
1185780052 X:2836165-2836187 CATTGTCTGCAAATGTAAGCTGG - Intronic
1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG + Intergenic
1187216492 X:17282157-17282179 CACTGTGTGCACAGGCAAGGTGG - Intergenic
1188657932 X:32721347-32721369 AAGTGCCAGTAAAGGCAAGGAGG - Intronic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1190738432 X:53271144-53271166 CAGTGTCCGCAAAGGCCTGGAGG - Intronic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1191626365 X:63275333-63275355 CAGTATTGGCAAAGGCCAGGTGG - Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1193330781 X:80233315-80233337 CAGCGTGTGCAAGGGAAAGGCGG - Intergenic
1193558160 X:82982470-82982492 CAGAGTCTGAAAAGGGAAGCTGG + Intergenic
1193932909 X:87579117-87579139 TAGTTTCTCCAAAGGCAAGAAGG + Intronic
1196919544 X:120571627-120571649 CAGTGTGTGCAAAGACATGGAGG + Intronic
1199707116 X:150437300-150437322 CAGTGTCAGCGATGGCAATGTGG + Intronic
1201289995 Y:12413824-12413846 CATTGTCTGCAAATGTAAGCTGG + Intergenic